ID: 998095614

View in Genome Browser
Species Human (GRCh38)
Location 5:139394271-139394293
Sequence AGGTGGCGCTGCTCGGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 265}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998095601_998095614 -2 Left 998095601 5:139394250-139394272 CCGACCGCCCCGTGGACCCGAAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265
998095598_998095614 13 Left 998095598 5:139394235-139394257 CCCGGGTCTCAGGTTCCGACCGC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265
998095597_998095614 19 Left 998095597 5:139394229-139394251 CCGTTTCCCGGGTCTCAGGTTCC 0: 1
1: 1
2: 1
3: 23
4: 293
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265
998095599_998095614 12 Left 998095599 5:139394236-139394258 CCGGGTCTCAGGTTCCGACCGCC 0: 1
1: 0
2: 0
3: 3
4: 276
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265
998095603_998095614 -6 Left 998095603 5:139394254-139394276 CCGCCCCGTGGACCCGAAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265
998095606_998095614 -10 Left 998095606 5:139394258-139394280 CCCGTGGACCCGAAGGTGGCGCT 0: 1
1: 0
2: 1
3: 3
4: 69
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265
998095605_998095614 -9 Left 998095605 5:139394257-139394279 CCCCGTGGACCCGAAGGTGGCGC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998095614 Original CRISPR AGGTGGCGCTGCTCGGGGCC GGG Exonic
900018753 1:172212-172234 AGGTGGTGCTGGTGGGGGCTGGG - Intergenic
900049011 1:530807-530829 AGGTGGTGCTGGTGGGGGCTGGG - Intergenic
900071242 1:772631-772653 AGGTGGTGCTGGTGGGGGCTGGG - Intergenic
900199750 1:1399187-1399209 AGGGGGTGCTGATCGGGGACAGG - Exonic
900995701 1:6122160-6122182 AGGTGCAGCTTCTCAGGGCCTGG + Intronic
902511484 1:16969241-16969263 GGCTGGCACTGCTCTGGGCCAGG - Exonic
902650232 1:17832607-17832629 AGGTGGGGCTGCTGGGGACATGG + Intergenic
903071893 1:20730844-20730866 AGGTGGCCCTGCTCAGAGACAGG + Intronic
903340949 1:22653938-22653960 ATGTGGCACTGCACGGGGCAGGG + Intronic
905336989 1:37251555-37251577 AGGTGGCCTTGCTTGAGGCCAGG + Intergenic
906263146 1:44407850-44407872 GGGCGGGGCTGCTCGGGGGCTGG + Intronic
906296251 1:44650795-44650817 AGGTGGGGCTGCTGGAGGCGAGG - Exonic
906704094 1:47882099-47882121 AGGCTGCGCTGCTGGGGGCCTGG + Intronic
911163418 1:94704589-94704611 AAGTGGGGCTTCTCAGGGCCTGG - Intergenic
912384750 1:109265746-109265768 AGGTGGGGCTGCCTGGGGGCCGG - Exonic
912520990 1:110244545-110244567 AGGTGGCGCTGCTGGTGATCAGG - Intronic
912830698 1:112950902-112950924 AGGTGGCTCTGCTTGAGCCCAGG + Intronic
913186338 1:116373490-116373512 TGGTGGCGGTGCTCAGTGCCCGG - Intronic
914755106 1:150557988-150558010 AGCTGGCGGTGCTGGGTGCCGGG - Exonic
922321739 1:224494733-224494755 AGGTGGCCCAGGTCAGGGCCTGG + Intronic
924527265 1:244863696-244863718 CGGTGGCGCCGCCCGGGGCGAGG - Exonic
924607851 1:245550650-245550672 TGGAGGAGCTGCTGGGGGCCAGG + Intronic
1063979631 10:11443311-11443333 AGGTGGCGATGCCTGGAGCCAGG + Intergenic
1064418214 10:15168630-15168652 GGGAGGCGGTGCTCGGGGCCGGG + Exonic
1067094895 10:43293946-43293968 AGATGGGGCTGCTCTGGTCCAGG - Intergenic
1070282219 10:75058244-75058266 AGGTGGCGCAGGGCGTGGCCTGG + Intronic
1071501328 10:86206322-86206344 AGCTGGGGCTGCTTGGGGACAGG - Intronic
1075144711 10:119873015-119873037 AGGCTGCGCAGCGCGGGGCCCGG + Intronic
1076723711 10:132403934-132403956 GGGTGGGGCTGCGCGTGGCCCGG - Intronic
1076829206 10:132985814-132985836 GGGTGGGGCTGCTGGGGGTCGGG + Intergenic
1076975355 11:167408-167430 AGGTGGTGCTGGTGGGGGCTGGG - Intergenic
1077142662 11:1031267-1031289 AGACGGCTCTGCTGGGGGCCCGG + Intronic
1077185115 11:1232286-1232308 AGGAGGAGGTGCTTGGGGCCAGG + Intronic
1077327317 11:1969393-1969415 GGGTGGGGCTGCCCGGGGGCTGG - Intronic
1077498306 11:2897321-2897343 AGGTAGCCCTGCGGGGGGCCTGG - Intronic
1077976356 11:7252179-7252201 GGGGGGCGATGCCCGGGGCCAGG + Exonic
1080873806 11:36259242-36259264 AGGTGGGGCTGCTGGGAGCCTGG - Intergenic
1081831875 11:46121436-46121458 AGGTGCTGCGGCCCGGGGCCGGG - Intergenic
1083237714 11:61362233-61362255 AGCTTTCGCTGTTCGGGGCCCGG - Exonic
1083594433 11:63912132-63912154 AGGGGGCACTGATCGGGGCACGG + Exonic
1083622291 11:64055197-64055219 AGGAGGTGCTCCTCTGGGCCGGG + Intronic
1084087211 11:66860122-66860144 ATGGGGGGCTGCTCGGGGCAGGG + Exonic
1084091505 11:66882001-66882023 TGGTGGCCCTGCTGGAGGCCAGG - Intronic
1084284110 11:68120769-68120791 AGGTGACGCGGGGCGGGGCCGGG - Intronic
1084598860 11:70133092-70133114 AGGTGGCGCTATTCTGGCCCCGG - Intronic
1084636756 11:70398288-70398310 CCGCGGCGCTGCCCGGGGCCGGG - Intergenic
1084793344 11:71488970-71488992 GGGTGGCTTTGCTGGGGGCCTGG + Intronic
1084849733 11:71929091-71929113 AGGTGGTGCTGCTGGGGAACGGG + Exonic
1085017107 11:73181284-73181306 AGCTGGAGGTGCACGGGGCCAGG + Intergenic
1087441440 11:98188643-98188665 ATGAGCCACTGCTCGGGGCCTGG + Intergenic
1089197318 11:116701807-116701829 AACTGGCTCTGCTGGGGGCCGGG - Intergenic
1089943264 11:122441229-122441251 AGGTGGGGCAGCGCGGGGGCGGG + Intergenic
1091226051 11:133956941-133956963 AGGTGCCGCTGCGCCGGGGCCGG - Exonic
1202810299 11_KI270721v1_random:24573-24595 GGGTGGGGCTGCCCGGGGGCTGG - Intergenic
1091600951 12:1917427-1917449 AGGTGGCTCTGTTGGTGGCCTGG + Intronic
1091624217 12:2110229-2110251 AGGTGCTGCTGCTGGGGACCAGG - Intronic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1095953715 12:47795218-47795240 AGGCGGGGCTGCATGGGGCCCGG + Exonic
1096192641 12:49630564-49630586 GGCAGGCGCTGCTGGGGGCCGGG - Exonic
1096675038 12:53221687-53221709 TGCTGGCGCTGTCCGGGGCCAGG - Intronic
1099573617 12:84356356-84356378 AGGTGGGGCTCCTGGAGGCCCGG + Intergenic
1102933800 12:116881056-116881078 AGGTGGCGGCGCTGGCGGCCTGG - Exonic
1103309125 12:119990044-119990066 AGCTGGCGCTGCTGGCGGCCGGG + Exonic
1103924983 12:124418632-124418654 ACCTGGAGCTGCTCCGGGCCTGG + Intronic
1103925564 12:124421895-124421917 ACCTGGAGCTGCTCCGGGCCTGG + Intronic
1105437903 13:20392289-20392311 TGGTGGCGCTGCGCGGGCCTGGG - Intergenic
1107654271 13:42575046-42575068 AGGTCGCGGTGCTCGTGCCCAGG + Intronic
1112290723 13:98142840-98142862 AGGTAGCGCCGCGCGGAGCCCGG + Intronic
1113378624 13:109784788-109784810 AGGTGGCGCTGCTGCCGGCAGGG - Exonic
1114732830 14:25012396-25012418 AGGTGGGGGTACTCGAGGCCAGG + Intronic
1116463129 14:45201105-45201127 AGAAGGCTCTGCTTGGGGCCGGG + Intergenic
1116817882 14:49599845-49599867 GGGAGTCGCTGCTTGGGGCCGGG + Intronic
1117478498 14:56119408-56119430 GGATGCGGCTGCTCGGGGCCTGG + Intronic
1117548026 14:56809052-56809074 AGGTGTCGTGGCTCGGGGCCGGG - Intronic
1118776808 14:68978702-68978724 AGGTGGCGCCGCTGGCGGGCAGG - Intronic
1121329924 14:93043555-93043577 AGGTGGGGCTGGGCGGGGCAGGG - Intronic
1122266174 14:100547900-100547922 AGATGCCTCTGCTCGGGGCTGGG - Intronic
1122720951 14:103722051-103722073 AGGAGGCGCTGGTGGGAGCCTGG + Intronic
1122904510 14:104795601-104795623 CGGGGGCGCTGCTCGGGGCCGGG + Intronic
1124190710 15:27574257-27574279 AGGTGGCGCTGCGGCGGGTCGGG + Intergenic
1125594161 15:40873785-40873807 AGGTGGCGCTGGTGCGGCCCAGG - Intronic
1126317282 15:47383527-47383549 ATGTGGCACTGCCAGGGGCCTGG + Intronic
1126786279 15:52179961-52179983 GCGGGGCGGTGCTCGGGGCCGGG - Intronic
1128330987 15:66755565-66755587 AGGTTGCGGTGCTCAGGGTCAGG + Intronic
1128354016 15:66911694-66911716 AGCTGGAGCCGCTGGGGGCCTGG + Intergenic
1129673212 15:77618328-77618350 AGGTGGCTTTGCTCAGGGACTGG - Intronic
1130014245 15:80174920-80174942 AGCAGGTGCTGCTGGGGGCCTGG + Intronic
1130632251 15:85581098-85581120 AGGTGGGGCTGCCCAGAGCCTGG + Exonic
1132583419 16:695330-695352 GGGCGGGGCTGCACGGGGCCGGG - Intronic
1132756485 16:1487791-1487813 AGCTGGCGCAGCTCAAGGCCTGG - Exonic
1133057290 16:3151972-3151994 AAGAGGCGCTGCTCGGCACCCGG - Intergenic
1134645083 16:15858745-15858767 AGGTGGAGGGGCTGGGGGCCGGG + Intergenic
1136021660 16:27444469-27444491 AGGTGGCTCTGCTGGAGGCAGGG + Intronic
1136065293 16:27754421-27754443 AGGTGGCCCTGCTAGGGCCAGGG - Intronic
1137683939 16:50373028-50373050 AGCTGGAGCTGCTGGGAGCCTGG - Intergenic
1138104817 16:54282380-54282402 AGGGGGCGCGGCGCGCGGCCGGG + Intergenic
1142129884 16:88427710-88427732 CAGGGGTGCTGCTCGGGGCCTGG - Exonic
1142164265 16:88577390-88577412 AGGGGGAGCTGGTCGGGCCCCGG - Exonic
1142231472 16:88902112-88902134 AGGTGGCGCTGCTGCTGGTCTGG + Intronic
1142262171 16:89048138-89048160 GGCCGGCGCTGCTGGGGGCCAGG + Intergenic
1142444905 16:90130251-90130273 AGGTGGTGCTGGTGGGGGCTGGG + Intergenic
1142462606 17:105215-105237 AGGTGGTGCTGGTGGGGGCTGGG - Intergenic
1142474555 17:181315-181337 GGGTGCAGCGGCTCGGGGCCCGG + Exonic
1143631389 17:8142375-8142397 GGCTGGGGCTGCTCGGGGCGGGG - Exonic
1143782171 17:9234630-9234652 AGGGGGCTCTGCTCAGGGCAGGG - Intronic
1146257349 17:31399156-31399178 TGGTGGCACTGCTCAGGGCTGGG - Intronic
1146277606 17:31525209-31525231 AGGTGGAGCTGCTCAATGCCAGG + Exonic
1146370949 17:32265630-32265652 TGGTGGCGCTGCCCGGGGCGGGG - Intergenic
1147210420 17:38869918-38869940 ACGTGGGGCTGCGCGGGGGCGGG - Exonic
1147620824 17:41865500-41865522 AGGCGGCGCTGCTGGAGGCGAGG - Intergenic
1147620828 17:41865520-41865542 AGGCGGCGCTGCTGGAGGCGAGG - Intergenic
1147620832 17:41865540-41865562 AGGCGGCGCTGCTGGAGGCGAGG - Intergenic
1147996748 17:44363768-44363790 AGCTGGGGCTGCGCGGGGCCGGG - Exonic
1149626519 17:58083918-58083940 TCGTGGCGCTGCTGGAGGCCCGG + Intronic
1149994573 17:61399970-61399992 CGGGGGCTCTGCGCGGGGCCGGG - Exonic
1150475349 17:65470782-65470804 AGGTGGGGCTGCCCAGGGGCTGG + Intergenic
1151260578 17:72912837-72912859 AGGGGGCGCAGCTCAGGGTCTGG - Intronic
1151338689 17:73455967-73455989 AGCTGGCGATGCGCGGGGCACGG + Exonic
1152396292 17:80035721-80035743 AGGGGGCGCTGCTCGCTGCGCGG + Intronic
1152654883 17:81514833-81514855 GGATGGCGCTGCCCCGGGCCGGG - Intronic
1152683414 17:81681930-81681952 AGGTGGTGCAGCTGGGGGTCCGG - Intronic
1153143618 18:2002822-2002844 AGGAAGGGCTGCTTGGGGCCAGG + Intergenic
1153855123 18:9137286-9137308 CGGGGGCGCTGCGCGGGGCGGGG + Intronic
1156969718 18:43139831-43139853 GGGTGGCGCTTGTCGGGGCTTGG - Intergenic
1157610438 18:48951967-48951989 GGCTGGCGCGGCTCGGGGACAGG + Intergenic
1159997857 18:74983866-74983888 AGGCTGAGCTGCTCGGTGCCAGG - Intronic
1160544037 18:79641089-79641111 AGGTGGGGGTGCCGGGGGCCGGG - Intergenic
1160652311 19:237591-237613 AGGTGGTGCTGGTGGGGGCTGGG - Intergenic
1160735972 19:662629-662651 CGGTGGCGCGGCGCGGGGCAGGG - Intronic
1160818616 19:1047664-1047686 AGGGGGCGGGGCTCCGGGCCGGG + Intronic
1160869646 19:1271400-1271422 TGGTGGCTCTGCCGGGGGCCGGG + Exonic
1160930671 19:1568208-1568230 GCGCGGGGCTGCTCGGGGCCGGG + Intergenic
1160947803 19:1651815-1651837 TGCAGGCGCTGGTCGGGGCCGGG - Intronic
1161340451 19:3739031-3739053 GCGTGGCTCTGCCCGGGGCCGGG - Exonic
1162118278 19:8445309-8445331 GGGTGGCGAGGCTCGAGGCCCGG - Intronic
1162343525 19:10106437-10106459 AGGTGGCGCAGGTGGGGTCCCGG + Intronic
1163019103 19:14473243-14473265 AGGTGGGGCCTCTAGGGGCCGGG + Intronic
1165242866 19:34481728-34481750 AGGGGGCGCGGCCCGGCGCCTGG + Exonic
1165803240 19:38565602-38565624 AGGAGGCGGTGCACGAGGCCGGG + Exonic
1167441804 19:49513150-49513172 GCGTGGCGGAGCTCGGGGCCGGG + Intronic
1168152101 19:54454800-54454822 GGGTGGGGCTGCTCTGGACCAGG + Intronic
1168253384 19:55154093-55154115 TGCAGGCGCTGCTGGGGGCCCGG - Exonic
1168295170 19:55374608-55374630 AGGGGGCTCTGCAGGGGGCCGGG - Intergenic
1168300562 19:55402480-55402502 AGCTGGGGCTGCTGGAGGCCTGG - Intronic
1168643168 19:58043131-58043153 AGGTGGAGCTGCTCTGCGCGGGG + Intronic
924988025 2:288596-288618 TAGTGGCGCAGCTCGGGGCGCGG - Intronic
925102486 2:1259898-1259920 TGGTGGGGCTGCCCGGAGCCTGG + Intronic
925329155 2:3044835-3044857 AGGTGGCTCTGCAGGGGTCCAGG + Intergenic
925377930 2:3401374-3401396 AGGTGACACTGCTGGGGACCAGG - Intronic
928432808 2:31234519-31234541 CGGCGGCGCGGCTCGGAGCCCGG + Exonic
928876175 2:36042449-36042471 AGCTGGAGCTGCTTGGGTCCAGG + Intergenic
931021194 2:58046824-58046846 AGGAGGCGGTGCGCGCGGCCCGG + Intronic
931728247 2:65130693-65130715 TGGTGGCGCTGGTTGGGGGCTGG + Intergenic
932134184 2:69214041-69214063 TGGAGGCGCTGCTCTGGCCCTGG - Intronic
934536586 2:95139369-95139391 AGGTGGAGCTGCCCAAGGCCTGG + Intronic
934660096 2:96138664-96138686 AGGTGGAGCTGGTTGGGGCGGGG - Intergenic
934678171 2:96264981-96265003 AGGTGGCTCTGTTTGGGGTCCGG - Intronic
936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG + Exonic
936183635 2:110286912-110286934 AGGTGGCGCAGCGCGGTTCCTGG - Intergenic
937884750 2:126892058-126892080 AGGTGGGGCTGCTGTGGGCCAGG - Intergenic
939562792 2:143751919-143751941 AGGTGGAGCTTCTTGGGTCCAGG - Intronic
946024201 2:216662015-216662037 AGGAGGAGCTGCTCTGGCCCAGG - Intronic
947549887 2:231038198-231038220 AGGTGAGACTGCGCGGGGCCCGG + Exonic
948060619 2:235041182-235041204 AGCTGGAGCTGCTCGGGGGATGG + Exonic
948467190 2:238158264-238158286 TGGTGGGGCTGAGCGGGGCCTGG - Intergenic
1169068488 20:2707673-2707695 AGCTGGCTCTGCTTGGGGCAGGG - Intronic
1169343060 20:4810730-4810752 AGGTGGGGGTGGTTGGGGCCTGG - Intronic
1172834310 20:37863296-37863318 AGCTGGCCCTGCTCAGTGCCAGG + Intronic
1174085449 20:48004721-48004743 AGGAGGGGCTGCCCAGGGCCAGG + Intergenic
1174130771 20:48342011-48342033 AGGAGGGGCTGCCCAGGGCCAGG - Intergenic
1174199815 20:48799475-48799497 AGACCGCGCTGCTCGGGGCAGGG - Intronic
1174804178 20:53592701-53592723 GGAGGGCGCTGCTGGGGGCCCGG - Intronic
1175298039 20:57922818-57922840 CCGTGGGGCTGCTCGGGGCTCGG + Intergenic
1175582807 20:60113484-60113506 AGGAGGCTGTGCTGGGGGCCAGG + Intergenic
1175784442 20:61703705-61703727 AGGTGGCTCCACTCGGGGCAGGG + Intronic
1175968007 20:62669289-62669311 TGCTGGAGCTGCTGGGGGCCTGG - Intronic
1176238008 20:64063232-64063254 AGGTGGCGACGGCCGGGGCCGGG + Exonic
1178826716 21:36023677-36023699 AGGTGGGGCTGCTGGCCGCCCGG - Intergenic
1178882591 21:36461092-36461114 TGGTGGCCCTGGGCGGGGCCTGG + Exonic
1180560104 22:16609137-16609159 GGAGGGCGCTGCTGGGGGCCCGG - Intergenic
1181036170 22:20170707-20170729 AGGTGATGCTGTTCGGGGGCTGG + Intergenic
1183309944 22:37103917-37103939 AGCTGGCACTGCGCTGGGCCGGG + Intronic
1183535200 22:38397381-38397403 GGAGGGCGCTGCTGGGGGCCTGG - Intronic
1183586349 22:38755453-38755475 CGTAGGCGCTGCCCGGGGCCGGG + Intronic
1184281373 22:43439496-43439518 AGGTGGGGCGGCTGGAGGCCAGG + Intronic
1184501878 22:44879407-44879429 AGGAGGCGGTGCTCAGGGTCAGG + Intergenic
1184796889 22:46738027-46738049 TGGTGGCGGAGCCCGGGGCCCGG - Exonic
949870234 3:8582104-8582126 GGGTGGCTCTGCTGGGGTCCCGG - Intergenic
950415895 3:12868973-12868995 TGGAGGCGCTGAACGGGGCCAGG + Intronic
952451760 3:33440054-33440076 GGGTGGCGCTGCCGGCGGCCCGG - Exonic
952751420 3:36827877-36827899 AGTTGCTGCTGCTCTGGGCCAGG - Exonic
954693320 3:52407299-52407321 AGGTGGCGTGGCTCGGGCCTGGG + Exonic
961688333 3:128650725-128650747 AGGAGGCGCTGCCCGGCGCCGGG + Exonic
961735744 3:129001387-129001409 TGGTGGCGCTGCCGGGGTCCCGG + Intronic
964438269 3:156675602-156675624 AGTTGGCGCGGCCCGGGACCAGG + Intronic
966806498 3:183811683-183811705 AGGTGGCGCTGCCAGGTGCCCGG + Exonic
966875145 3:184317341-184317363 AGGCTGCACTGCTCGGGGGCTGG - Exonic
966883741 3:184363211-184363233 AGGTGGCTCTGCCCAGGGCGGGG - Intronic
967056274 3:185831526-185831548 AGGAGGGACTGCTCGAGGCCAGG + Intergenic
967883159 3:194315687-194315709 AGGTGCCGATGCACGGGGGCGGG + Intergenic
968365522 3:198182381-198182403 AGGTGGTGCTGGTGGGGGCTGGG + Intergenic
968804684 4:2764370-2764392 TGGGGGCGCTGGTCGGGGCGCGG - Intergenic
968916690 4:3499798-3499820 AGGGGGAGGTGCTGGGGGCCAGG + Intronic
971953628 4:33386964-33386986 AGGTGGCACTGCTTGGAGTCTGG + Intergenic
976527905 4:86115136-86115158 AGGTGGCACAGCTCTGTGCCTGG + Intronic
978617473 4:110611561-110611583 ACGCGCCGCTGCTCCGGGCCTGG - Intergenic
985643484 5:1074394-1074416 GGATGGCGCAGCTGGGGGCCGGG - Intronic
985849842 5:2380941-2380963 AGGTGGAGGTGCTGGGGGCGGGG + Intergenic
987140166 5:14937710-14937732 ACGGGGTGCTGCTGGGGGCCAGG + Intergenic
993386494 5:87268368-87268390 GGGTGGGGCTGCTCGGAGCCCGG + Exonic
994180738 5:96763266-96763288 TGGTAGAGCTGCCCGGGGCCAGG - Intronic
997747614 5:136312801-136312823 AGGTGGTGCTGCTCTGTGGCTGG - Intronic
998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
999147744 5:149407037-149407059 AGGTGTGGCTCCTTGGGGCCTGG - Intergenic
1002184305 5:177447086-177447108 GGGAGGGGCTGCTCGCGGCCCGG - Intronic
1002194807 5:177496077-177496099 AGGTGGCAATGCTTGGAGCCAGG - Intronic
1002425295 5:179171403-179171425 AGGTGGCACTGCTAGGGGCTGGG - Intronic
1003051258 6:2783001-2783023 CGGTGGGCCTGCTCGGAGCCAGG - Intronic
1003645414 6:7910248-7910270 GGGCGCCGCGGCTCGGGGCCGGG - Intronic
1004395770 6:15245548-15245570 AGGCGGCTCTCCCCGGGGCCGGG + Intergenic
1006334060 6:33411229-33411251 AGGAGGCGCTGGTGGGGGGCAGG + Intronic
1006387123 6:33737486-33737508 AGCTGGCTGTGCTCGTGGCCTGG - Intronic
1007614300 6:43171429-43171451 AGGGGGCGCTGCGCGCGGCCTGG + Exonic
1007664187 6:43505012-43505034 GGGTGGGGCTGCCAGGGGCCGGG - Exonic
1013556196 6:111259549-111259571 AGGTGGAGCTCCGTGGGGCCGGG + Exonic
1014009739 6:116462046-116462068 AGGCGGCGCTGCACGGGCACTGG - Exonic
1016749616 6:147618434-147618456 AGGTGGGGCTGATTGGAGCCTGG + Intronic
1019450875 7:1097207-1097229 GGGTGGCAGTGTTCGGGGCCAGG - Intronic
1019559575 7:1649260-1649282 ATGTGGCACAGCTGGGGGCCAGG - Intergenic
1020278125 7:6636988-6637010 AGGGGGCCCAGCGCGGGGCCTGG + Intergenic
1021257421 7:18410245-18410267 AGGTGGGACTGCATGGGGCCAGG + Intronic
1022370929 7:29770611-29770633 AGGTGGCCTTGCTCGCTGCCAGG - Intergenic
1022443352 7:30451398-30451420 AGGTGGGGCAGCTGGCGGCCAGG - Exonic
1022509295 7:30925015-30925037 TGGTGGAGCTGCTCTGGCCCTGG - Exonic
1024537546 7:50450457-50450479 AGGTGGCGGTGCCCGGGCCCAGG - Intronic
1025258029 7:57398779-57398801 AGGTGGGGCGGGGCGGGGCCCGG - Intergenic
1029461212 7:100694587-100694609 AGGTCGCGCGTCGCGGGGCCGGG - Intergenic
1029649330 7:101879981-101880003 AGGTGGCTTTGCTGGGGGCTGGG + Intronic
1032279172 7:130486951-130486973 TGGTGGCGCGGCTGGGGGCCTGG + Intronic
1033361284 7:140640573-140640595 TGGCGGCGCGGCTCGGGGGCGGG + Exonic
1034274026 7:149816267-149816289 AGGGGGCGCTGCCCAGGGCGGGG + Intergenic
1034387534 7:150753027-150753049 AGGTGGCACTGGTAGGTGCCTGG + Intergenic
1035212158 7:157336784-157336806 AGGGGGCGGAGCTCGGGGCCGGG - Intronic
1035725818 8:1824274-1824296 AGGGGGAGCTGCTCGGGGGGAGG - Intronic
1036810149 8:11862351-11862373 AGATGGCGCTGCTCTGAGCCTGG - Intronic
1037273948 8:17157231-17157253 GTCTGGCGCAGCTCGGGGCCGGG - Intronic
1038379312 8:27077504-27077526 TAGTGGGGCTGCTCGGGGGCAGG + Intergenic
1039531656 8:38268587-38268609 TGGTGGCGCTGCCTGGCGCCCGG - Intronic
1039842284 8:41302793-41302815 AGGAGGAGCTGGTGGGGGCCAGG - Intronic
1040546767 8:48404064-48404086 AGGAGGTGCTGCTACGGGCCTGG - Intergenic
1040890876 8:52314723-52314745 AGGAGGCTCTGGTTGGGGCCAGG - Intronic
1041686687 8:60651759-60651781 CGGTGGCGCCGCACGGGGCCGGG - Intergenic
1045112413 8:98947914-98947936 AGGGGTCGCTCCTCGGTGCCAGG + Intronic
1047786532 8:128158859-128158881 AGGCGGTGCTCCTGGGGGCCTGG + Intergenic
1048333424 8:133486326-133486348 GTGTGGCGCAGCTCAGGGCCTGG + Intronic
1049162458 8:141106070-141106092 AGGAGCCACTGCTGGGGGCCAGG - Intergenic
1049174993 8:141186800-141186822 AGGAGGGGCCGCTGGGGGCCTGG - Intronic
1049416950 8:142499653-142499675 GGGTGGGGCTGCTCAGGCCCTGG + Intronic
1049421220 8:142517480-142517502 AGGTGGGGATGCCTGGGGCCAGG + Intronic
1049564826 8:143332523-143332545 AGGTAGTGCTGTTGGGGGCCTGG + Intronic
1049587180 8:143437513-143437535 AGATGGTGCTGCTCAGGTCCAGG + Intergenic
1049623411 8:143609437-143609459 AGGTGGGGCGGCGCGGGGCTAGG - Exonic
1049773312 8:144393632-144393654 AGGGGGTGCTGCACGGGGGCGGG + Intronic
1049777304 8:144412722-144412744 GGGAGGGGCTGCTCTGGGCCGGG - Intronic
1051663663 9:19448238-19448260 AGGTGGACCTGCTCGAGCCCAGG - Intronic
1051894197 9:21971056-21971078 TGGTGGTGCTGCACCGGGCCGGG - Exonic
1051897737 9:22006095-22006117 TGGTGGTGCTGCACCGGGCCGGG - Exonic
1053424236 9:38000572-38000594 AGGTGGCGCTGTTCCGAGGCCGG + Intronic
1054809954 9:69426819-69426841 AGAAGGGGCTCCTCGGGGCCAGG + Intergenic
1056386275 9:86099579-86099601 CGCCGGCGCTGCTCGGGGGCGGG - Intronic
1056922248 9:90801527-90801549 AGGTGGGGCTGCCCGGGACATGG - Intergenic
1058315859 9:103565006-103565028 AGGTGGTAATGGTCGGGGCCTGG + Intergenic
1059305320 9:113349522-113349544 AGGTGGCGGCGGGCGGGGCCTGG - Exonic
1059343396 9:113612411-113612433 AGGTAGGGCTACTCAGGGCCTGG + Intergenic
1060990646 9:127846802-127846824 AGGAGGAGCCGCTGGGGGCCTGG + Intronic
1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG + Intergenic
1062360661 9:136186487-136186509 AGGCGGTGGTGGTCGGGGCCTGG - Intergenic
1062376557 9:136264381-136264403 AGCTGGAGCTGGCCGGGGCCAGG - Intergenic
1062529190 9:136992480-136992502 AAGCGGGGCGGCTCGGGGCCCGG - Exonic
1062652794 9:137586946-137586968 AGGTGGGTCTTCTCAGGGCCTGG - Exonic
1062657693 9:137612796-137612818 AGGTGGTGCTGCTTGGCCCCAGG + Intronic
1062749890 9:138245248-138245270 AGGTGGTGCTGGTGGGGGCTGGG + Intergenic
1203780788 EBV:99665-99687 ATGTGGCGCTGTCCCGGGCCCGG - Intergenic
1189322841 X:40096962-40096984 AGGGGGCGCGGCTGGGGGCCTGG - Intronic
1197648676 X:129042360-129042382 GGGTGGGGCTGCCAGGGGCCGGG + Intergenic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic
1198312909 X:135437855-135437877 GGCTGGCGCTGCTCTAGGCCAGG - Intergenic
1199816009 X:151397360-151397382 AGGTAGCCCTGAGCGGGGCCTGG + Exonic