ID: 998098719

View in Genome Browser
Species Human (GRCh38)
Location 5:139413949-139413971
Sequence CCTTCCTGGGGAGTGGCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998098719_998098725 -2 Left 998098719 5:139413949-139413971 CCTGGAGCCACTCCCCAGGAAGG 0: 1
1: 0
2: 3
3: 36
4: 335
Right 998098725 5:139413970-139413992 GGATCCTGTGAAGACACATCTGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998098719 Original CRISPR CCTTCCTGGGGAGTGGCTCC AGG (reversed) Exonic