ID: 998099370

View in Genome Browser
Species Human (GRCh38)
Location 5:139419368-139419390
Sequence CTGTCTCCAGAGAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998099362_998099370 29 Left 998099362 5:139419316-139419338 CCTAGTAACACTTGCTGGAGCTG 0: 2
1: 0
2: 1
3: 17
4: 128
Right 998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 39
4: 305
998099364_998099370 2 Left 998099364 5:139419343-139419365 CCAGTGGCAGATGCTATCATCCC 0: 1
1: 0
2: 2
3: 12
4: 135
Right 998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 39
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998099370 Original CRISPR CTGTCTCCAGAGAGGGAAAT AGG Intronic
900098813 1:952303-952325 CTGTCTCCAGACAGGGGCTTCGG + Intronic
900707639 1:4090420-4090442 ATGCCTCCACAGGGGGAAATCGG + Intergenic
901106569 1:6760906-6760928 CTGTCTCAAGAAAAGGAAAAAGG + Intergenic
902360614 1:15940910-15940932 CTGCCTCCAGACAGGAGAATGGG + Intergenic
903756425 1:25664662-25664684 TTGGCTACAGAGTGGGAAATAGG + Intronic
904802406 1:33103139-33103161 CTGTCTGCAGCGTGGAAAATGGG - Intronic
905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG + Intergenic
905651583 1:39660587-39660609 CTGTTTCCAGTGAGGGAAACAGG + Intronic
905961545 1:42046457-42046479 CTGACACCAGAGAGGGCAAAAGG + Intergenic
906187134 1:43870785-43870807 GTGTCTGCAGAGAGGCAAAGTGG + Intronic
907985003 1:59521776-59521798 CTGTCTCCAGATTAGGAAAAGGG + Intronic
908962870 1:69722046-69722068 TTCTCTCTAGAGAGGGAAATTGG - Intronic
909747460 1:79115608-79115630 CTGCCTCCAGTGAGGAGAATGGG + Intergenic
909971283 1:81993459-81993481 CTGCCTCAAGAGAAAGAAATAGG - Intergenic
910899407 1:92103649-92103671 CTGTCTCTAGAGAGGAGAATGGG - Intronic
911201774 1:95051551-95051573 CTTTTTCCAGTGAGTGAAATGGG - Intronic
912394133 1:109326943-109326965 CTGTCTGCATAGAGGGCAACTGG - Intronic
917552775 1:176052698-176052720 TTGCCTACAGAGAGGGCAATTGG - Intronic
919144927 1:193621823-193621845 CTGTCTCAAAAGAGGGAAAGTGG - Intergenic
919160440 1:193823360-193823382 CTATTTCAAGAGAGAGAAATAGG + Intergenic
921082513 1:211754139-211754161 CTTACTCTGGAGAGGGAAATAGG - Intronic
922970257 1:229730079-229730101 ATGGCTCCAGAGTGGGGAATGGG - Intergenic
923344090 1:233034367-233034389 CTGTCTGCAGACCAGGAAATGGG + Intronic
923588814 1:235300496-235300518 CTGTTTACAGATAGGGAAAATGG - Intronic
923737462 1:236624277-236624299 CTGTCTCCGAAAAAGGAAATAGG + Intergenic
1063472358 10:6298305-6298327 CTGGCTCAAGAAAGGGAAGTAGG + Intergenic
1063686469 10:8241569-8241591 ATGTCCCCTGAGAGGCAAATTGG + Intergenic
1064660189 10:17600100-17600122 GTGTCACCAGAGAGAGAAGTAGG - Intronic
1064883300 10:20081270-20081292 CTATATCCAGGGAGGGGAATAGG + Intronic
1065139914 10:22710319-22710341 CAGTCCCCAGAGAGGGGAAAGGG - Intronic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1066186768 10:33016969-33016991 ATGTCCCCAAAGAGGGAAACTGG - Intergenic
1068419651 10:56773481-56773503 GTGTCTCCAGAGTGTGAAAGGGG - Intergenic
1068765811 10:60762460-60762482 CTGTCTCAAGACAGTGAACTGGG - Intergenic
1068858883 10:61826498-61826520 CTGTCTCCAGAGAGCACATTTGG - Intergenic
1068985432 10:63103944-63103966 ATGCCTCCAGCGAGGGAAATTGG + Intergenic
1069838135 10:71322149-71322171 CTGTCTCTAAGGAGGGAAACTGG - Intronic
1070372306 10:75793954-75793976 CTGTCCCCATAGTGGGAAAACGG + Intronic
1070560562 10:77563603-77563625 CAGTCTCCATAGAGGAAAAAGGG + Intronic
1070721711 10:78761471-78761493 CTGGCTCCAGAGAGGGAGACAGG + Intergenic
1072541339 10:96400474-96400496 CTGTTTCCAAACTGGGAAATGGG - Intronic
1072943859 10:99791801-99791823 CTTTCTCCAGAGTGAGCAATCGG + Intronic
1073608709 10:104922090-104922112 TTGTATCCAGAGAGCGACATTGG - Intronic
1074590656 10:114809845-114809867 CTCTCTCCAGAGAGGAGGATGGG + Intergenic
1074888271 10:117712168-117712190 CTTTCTCTAGAGAGGTCAATGGG + Intergenic
1075274313 10:121079554-121079576 CTCTCCCCTGAGAGAGAAATAGG + Intergenic
1075316528 10:121457901-121457923 CTGAAACCAGAGAGGGAAACTGG + Intergenic
1076111749 10:127865080-127865102 CAGCCTCCAGAGAGGGGAAAAGG + Intergenic
1077981330 11:7303433-7303455 TTGTTGCCAGAGAGGGGAATGGG - Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1081889532 11:46529298-46529320 CTGTTTCCAAAGGGGGAAAATGG - Intronic
1083193671 11:61070056-61070078 GTGTCCCCAGATAGGGGAATGGG + Intergenic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084534878 11:69750761-69750783 CTGTCTGCGGAGAGGGCCATGGG - Intergenic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1086953004 11:92909822-92909844 CTGTCACCAGAGAAGGTGATGGG + Intergenic
1087695693 11:101373264-101373286 CTGATTTCAGAGAGGGGAATGGG + Intergenic
1089101273 11:115964797-115964819 GTGTCTTCAGAAGGGGAAATGGG - Intergenic
1089120888 11:116134166-116134188 CTGTCTCCGGAAAGGAAATTTGG - Intergenic
1090670946 11:128944891-128944913 CTGTGTCAAGAGATGGGAATAGG - Intergenic
1090826535 11:130391109-130391131 TTGTCTTCAGAGTGGAAAATCGG - Intergenic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1091671677 12:2456613-2456635 CAGTCTCCAGATAGTGAAGTGGG + Intronic
1092016230 12:5161137-5161159 CTCTCTCCAGAAAGGAAAAACGG + Intergenic
1092829888 12:12433569-12433591 ATGTTTCCATTGAGGGAAATTGG + Intronic
1094201063 12:27794848-27794870 GAGTCACCAGAGAGGGACATTGG - Intronic
1095321897 12:40838166-40838188 CTGGTTCCAGAGTGGTAAATTGG - Intronic
1095485500 12:42680216-42680238 CTGTAGCCAGAGTGGTAAATGGG + Intergenic
1096123613 12:49104439-49104461 CTGGCTCCAGAAAGGTAAGTAGG - Exonic
1096478823 12:51924583-51924605 CTTTGTCTAGATAGGGAAATTGG - Intergenic
1096598541 12:52713819-52713841 CTGCCTACAGGGAGGGGAATGGG + Intergenic
1096826455 12:54281928-54281950 CTGTCTCCAGAGAAGTGAGTGGG + Exonic
1097952121 12:65443014-65443036 CTGCCTTCACAAAGGGAAATAGG + Intronic
1101397315 12:104359717-104359739 CCGTCTATGGAGAGGGAAATAGG + Intergenic
1101751761 12:107587824-107587846 TTGTCTCCAAAGAGGTGAATTGG + Intronic
1102275641 12:111580131-111580153 CTGTCTGCAGAGAGGAGCATTGG - Intronic
1102906065 12:116676063-116676085 CTGTTGCCAGAGGTGGAAATTGG + Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103734522 12:123050843-123050865 CCTTCTCCAGGGAGGGAAACAGG + Intronic
1103751050 12:123161460-123161482 CTATATCCAGAAAGTGAAATTGG - Intronic
1104005951 12:124892575-124892597 CTATCTCAAGAGAGGGAGAGAGG - Intergenic
1104865070 12:131948969-131948991 CTGTCTCCAGATAAAGACATAGG - Intergenic
1104977859 12:132560245-132560267 CGGACTCCAGAGAGGGAATTGGG + Intronic
1105907000 13:24821980-24822002 CTGTCTCTAGTGAGAGAAAGGGG + Intronic
1106674129 13:31939768-31939790 GTGTCTTTAGAGAGGGAAATGGG + Intergenic
1108556268 13:51595874-51595896 ATGCCTCCAGAGAGGGAATCAGG - Intronic
1108749778 13:53436874-53436896 CTGCCTCCAGAAATGCAAATAGG + Intergenic
1109257743 13:60103784-60103806 CTGTCACAAGAGAGGGAATTAGG - Intronic
1110925456 13:81145474-81145496 CTGTCTCCAGAGTTGCAGATGGG + Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1111919704 13:94397203-94397225 GTCTCTCCAGTGAGAGAAATGGG + Intronic
1114439647 14:22735955-22735977 GGGTCTCAAGAGAGGGAAAATGG - Intergenic
1115523803 14:34259329-34259351 CTGTCTGCAAAGAGGAAAGTGGG + Intronic
1117412722 14:55465642-55465664 CTGGCTCCGAAGGGGGAAATGGG + Intergenic
1117487941 14:56217318-56217340 CTGTCTTCTGGGAGGGGAATGGG + Intronic
1118769995 14:68936398-68936420 CTGCCTCCAGGGAGAGAAATGGG + Intronic
1119225975 14:72944785-72944807 CTGTCTCAAGAGAAAAAAATAGG + Intronic
1120959518 14:90111737-90111759 CTGCCTGCACAGAGGGAAAGTGG - Intronic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1122565851 14:102655249-102655271 CTGCCTCCAGGAAGGGAAAATGG - Intronic
1122637208 14:103135755-103135777 CTGTCTCCAGAGAGCTGAAGAGG - Exonic
1123631802 15:22266278-22266300 CTGTCTGCAAAGAGGGGAACTGG - Intergenic
1125181208 15:36882483-36882505 GTGTCTCCAAAGATGGGAATGGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1127151087 15:56076146-56076168 CTGTCTTCGGATGGGGAAATGGG - Intergenic
1128626403 15:69210013-69210035 CTGGCTTGAGAGAGGGAAAGGGG - Intronic
1129342669 15:74896372-74896394 CTTTGTCCAGATAGGGAAACAGG - Intronic
1129811096 15:78510596-78510618 CTAACTCCAGTGAGGGAAAGGGG - Intronic
1129888020 15:79052238-79052260 GTGTCTCCAGAGAGGGGAGTAGG - Intronic
1131401204 15:92126950-92126972 CTGGCTCTAGAGAGAGAAACTGG - Intronic
1133453548 16:5923145-5923167 CTGTAACCAGAGAGGAAAAACGG + Intergenic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1136518403 16:30781669-30781691 CTCTCTCCAGAGAGGAACACTGG - Exonic
1138499436 16:57430086-57430108 CTGTCTCCTGAGAGTGAGAGTGG - Intronic
1138599429 16:58046102-58046124 CTTTCTCCAGAGAGGGAAGGAGG - Exonic
1138682346 16:58694505-58694527 CTGTCTCAAGAGAGCGAGAAGGG - Intergenic
1138774605 16:59706401-59706423 ATGTCTCCAGAGAGGGGATCAGG - Intergenic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1139553196 16:67687969-67687991 CTGTCTCAAGAAAGGAAAAAAGG + Intronic
1139684629 16:68593401-68593423 TTGTCTCCAGAGAGGGCAGAAGG + Intergenic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1140434752 16:74937504-74937526 CTGCCTCAAGAAAGGGAAAGAGG - Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1141668787 16:85480622-85480644 CTGTCTCCCAGGAGGGCAATCGG - Intergenic
1142029565 16:87831801-87831823 CCGCCTGCAGAGAGGGAACTAGG - Exonic
1142286358 16:89173106-89173128 CTGTCTCCAGATGGGGGAGTCGG - Intronic
1143570514 17:7755151-7755173 CTTTCTGCAGAGAGGGCAACAGG + Intronic
1144195374 17:12889850-12889872 CTATCTCAAAAGAGAGAAATAGG + Intronic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1145908887 17:28531459-28531481 CTGCCTCTAGAGAGGGAGCTGGG - Intronic
1146176491 17:30668831-30668853 GAGTTTCCAGAGAGGGAAACTGG + Intergenic
1146349951 17:32084945-32084967 GAGTTTCCAGAGAGGGAAACTGG + Intergenic
1146827631 17:36037193-36037215 TTGCTTCCAGAGAAGGAAATGGG + Intergenic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1149173800 17:53845116-53845138 CTCTCAACAGAGAGGGAAATGGG + Intergenic
1149638176 17:58186636-58186658 TCTTCTCCAGAAAGGGAAATGGG - Intergenic
1151702872 17:75752639-75752661 CTGGGTCCAGAGAGGGCAAAGGG + Intronic
1153880170 18:9415591-9415613 CTGCCTCCAGGGAGGGAAAACGG + Intergenic
1154258946 18:12811929-12811951 CTTTCTTCAGTGAGAGAAATGGG - Intronic
1155505001 18:26524726-26524748 CTGTCTCTAAAGAGGAAAATGGG + Intronic
1156149413 18:34224477-34224499 TTGTTTCCAGAGCTGGAAATAGG + Intronic
1161590590 19:5127552-5127574 CTGTCTCCAGACAGGGGATGGGG + Intronic
1162573972 19:11487893-11487915 CTGTCCCCACAGTGGGCAATGGG - Exonic
1163748508 19:19061836-19061858 CTATTTACAGAGAGGGAAACAGG + Intergenic
1167606662 19:50484898-50484920 CTGCCTCCAGGGAGGGGAAGTGG - Exonic
1167791697 19:51687622-51687644 CTGTCCCCAGAGAGGAGAACTGG + Intergenic
925850498 2:8076828-8076850 ATGTCTCCAGACAGGGCAAGAGG - Intergenic
926780286 2:16464706-16464728 CTGTCTCTAAAGTGAGAAATGGG - Intergenic
927968960 2:27292003-27292025 CTGTCTTGGGAGAGAGAAATCGG - Intronic
928178552 2:29051684-29051706 GTGTCCCAAGAGAGGGAAGTGGG + Intronic
928337124 2:30407690-30407712 ATGACTGCAGAGTGGGAAATGGG - Intergenic
928536946 2:32250271-32250293 CTGTCTCCAGAGAGGCCTCTTGG + Exonic
929496306 2:42447147-42447169 TTGACTCCAGGGAGGGGAATTGG - Intronic
929576576 2:43056235-43056257 CTGTCTCCAGATGGGCAAATGGG + Intergenic
929664590 2:43823771-43823793 CTTTCCCCAGAGAGGGAACCTGG + Intronic
929728309 2:44457150-44457172 TTATTTCCAGAGAGGGAAACTGG - Intronic
929862313 2:45689947-45689969 TAGTCTCTAGAGAGGGAAGTGGG - Intronic
930202885 2:48561366-48561388 CTGACTTCCGAGATGGAAATCGG - Intronic
930679313 2:54239537-54239559 CTATTTCAAGAGTGGGAAATGGG - Intronic
931139019 2:59436628-59436650 GTCTCTCCAGGGTGGGAAATGGG - Intergenic
931492268 2:62761216-62761238 CTGTCAACAGACATGGAAATAGG + Intronic
932257340 2:70299309-70299331 TTTGCTCCAGAGAGGGAAACAGG + Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
933684337 2:85131711-85131733 CTGTGTCCTGAGGGGGAAAGAGG + Intergenic
934069947 2:88374563-88374585 CTGGGGCAAGAGAGGGAAATGGG + Intergenic
935322222 2:101900307-101900329 CTGTCTCCAGAGGAGGAATGAGG - Intergenic
935715160 2:105932958-105932980 CTGTCTCCAAAGAGAGAATAGGG - Intergenic
935953100 2:108349051-108349073 CTGTCTGGAGGGAGGCAAATGGG - Intergenic
937599693 2:123716282-123716304 CTGTCCCCCAAGAGGGAAAGAGG - Intergenic
937631769 2:124109602-124109624 CTGTCCCCAGGCAGGGAAATCGG - Intronic
940035358 2:149307118-149307140 CTTTCTCAAGAGAGGAAAAGTGG + Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
942421729 2:175814683-175814705 CTGTCCCCAGAGAGTGAACATGG - Intergenic
942621407 2:177847839-177847861 ATGTCTACAGAGAGGGGTATGGG - Intronic
943395627 2:187329237-187329259 CTGTCCCAAAAGGGGGAAATTGG - Intergenic
944867784 2:203879548-203879570 CTGTAACCAGAGAGGAAAACAGG + Intergenic
946122375 2:217527618-217527640 CTGTCTCCTGAGAAGGAACTGGG + Intronic
946157442 2:217816314-217816336 CTGTCTTCAGAGACAGAAGTTGG + Intronic
946270592 2:218589752-218589774 CCTACTCCAGAGAGGGAAGTGGG - Intronic
946793528 2:223325697-223325719 CTTTCTCTTGAGAGGGAAAGAGG + Intergenic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
948511345 2:238467245-238467267 CTGTCTCCAGAAAACAAAATGGG - Intergenic
948785645 2:240351193-240351215 CTGTCTGCAGACGGGCAAATGGG - Intergenic
948909791 2:240997311-240997333 CTGTTTGCAGAGAGGCAAACTGG - Intergenic
1168954072 20:1821992-1822014 CTGGCTCAAGGGAGGGAAATGGG - Intergenic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1169362253 20:4960994-4961016 CTGCCTCCAGAGATGGAAACTGG + Intronic
1169498321 20:6135342-6135364 CTGTCACAGGAGAGAGAAATGGG + Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170595203 20:17800207-17800229 CAGTGTCCAGTTAGGGAAATAGG + Intergenic
1172045130 20:32074695-32074717 CTGTCTCCAGAGAGTCAACGCGG - Exonic
1172066555 20:32224791-32224813 CTGTCTAGCAAGAGGGAAATAGG + Intronic
1172313768 20:33937906-33937928 CTGTCTGCTGGGAGGAAAATAGG - Intergenic
1172887738 20:38242359-38242381 CTATTTGCAGATAGGGAAATTGG - Intronic
1173351647 20:42251034-42251056 ATGTCTCCAGCCTGGGAAATGGG - Intronic
1173914771 20:46698793-46698815 CAGTCTCCAGAGATGAGAATAGG + Intergenic
1178981294 21:37267382-37267404 CTGCCGGCAGAGAGGGAAAGGGG - Exonic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1180634955 22:17256873-17256895 CTGTCTCTGGAGAAGGAAACAGG + Intergenic
1181172521 22:21017771-21017793 TTGTCTCAAGAGATGGACATGGG + Intronic
1181176830 22:21042610-21042632 TTGTCTCAAGAGATGGACATGGG - Intergenic
1182992531 22:34781872-34781894 GTGCATCCAGAGAGAGAAATGGG - Intergenic
1183236616 22:36623491-36623513 CATTTTCCAGAGAGGGAAACTGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
952753699 3:36847278-36847300 CTGACTCCAGAGAGGAAAACCGG - Exonic
953737970 3:45512766-45512788 CTGCCTCCTGAAAGGGACATAGG + Intronic
953934005 3:47023993-47024015 CCATCTTGAGAGAGGGAAATAGG - Intronic
953971049 3:47347250-47347272 CTGTCTCTAGAGAGGGACTTAGG - Intergenic
954368227 3:50157128-50157150 CTGTCTCCAGGAAGGGAGGTTGG - Intronic
954916205 3:54150425-54150447 CCTTCTCCAGAGAGGGAAGGGGG - Intronic
956596842 3:70976541-70976563 CTATCTCCAGAGATGGAACCTGG - Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960052398 3:113251057-113251079 GTGTCTACAGAGAGGGGAATTGG + Intronic
960684115 3:120280090-120280112 CTGTGACCAGAGAGGCAACTTGG - Intronic
961521518 3:127469829-127469851 CTGTTTCCAGATGGGGGAATGGG - Intergenic
962343652 3:134604812-134604834 CTGTGTCCAGAGAGGGTCATGGG + Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
963040918 3:141069258-141069280 CTGACTCCAGAGTGGGCCATAGG + Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
964814516 3:160702413-160702435 TTTTTTCCAGAGAGGGAAATAGG - Intergenic
964873738 3:161342287-161342309 CTGGCTCCAAAGAGGGAAAAAGG - Intergenic
965229899 3:166037161-166037183 TTGTCTTCAGAGAAGGTAATGGG - Intergenic
967515170 3:190360228-190360250 CTGTTTCCAGGGAGGAAAATAGG + Intronic
968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG + Intronic
968737186 4:2303620-2303642 CTGTCTCCAGAGTGGGGGATGGG + Intronic
969496834 4:7531030-7531052 CAGAGTCCAGAGAGGGAAAGAGG + Intronic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
973588335 4:52414342-52414364 CTCTCTCCACACAGGGCAATGGG - Intergenic
974049137 4:56924026-56924048 CAGTCTCCATAGAAAGAAATAGG - Intronic
974205909 4:58703236-58703258 CTGTCTCATGAGAGGAAAGTCGG - Intergenic
979225790 4:118282883-118282905 CTCTCTCCAGAGTGGTAAACAGG + Exonic
981603073 4:146513102-146513124 TTGTCTCCAGAGAAGAAAACTGG + Intronic
983265269 4:165501445-165501467 CTGTCTCTAGGGAGGAAAATGGG - Intergenic
983637429 4:169912205-169912227 CTGCCTCCAGGGAAGGAAACTGG - Intergenic
984712584 4:182898022-182898044 CTGTCCTCAGAGAGGAAACTAGG + Intronic
986124253 5:4870368-4870390 TCCTCTCCAGAGAGGGAGATGGG - Intergenic
986266547 5:6196141-6196163 ATGCCTCCAGGGAGGGAAAGGGG - Intergenic
986378227 5:7155493-7155515 CTGGCTCCACAGAGTGAATTAGG + Intergenic
986684374 5:10263191-10263213 CTGTTTTCAGAGAGGGCCATGGG - Exonic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988400678 5:30756035-30756057 CTGACTCTAGTGAGGGAAAAAGG + Intergenic
988642542 5:33057252-33057274 CTATCTCCAGAGAAGAAACTGGG + Intergenic
989344447 5:40413517-40413539 CTTTCTCAAGAAAGAGAAATAGG + Intergenic
992212967 5:74498386-74498408 CTCTCTCCAGAGATGGATGTTGG - Intergenic
992936208 5:81708228-81708250 CTCTCTACAGAAAAGGAAATAGG + Intronic
993031622 5:82713164-82713186 CTGGCTCCAGAGAGTCAATTAGG - Intergenic
993398310 5:87417998-87418020 ATGTCTCCAGATAGAGAGATAGG + Intergenic
993418226 5:87663067-87663089 CTGAGACCAGAGAGGCAAATGGG - Intergenic
994028420 5:95113044-95113066 CTCCCTCCAGAGAGAGAACTAGG + Intronic
997516544 5:134493864-134493886 CAGCCTCTAAAGAGGGAAATGGG + Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998257097 5:140596417-140596439 CTGACTTCAGGGAGGGGAATGGG - Intergenic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1000683940 5:164223727-164223749 CAGTCCCAAGAGAGGGAACTAGG + Intergenic
1000924484 5:167177300-167177322 CAGTCACCAGTAAGGGAAATCGG + Intergenic
1001529187 5:172450691-172450713 CCCTCTCCAGTGCGGGAAATGGG + Intronic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1003238534 6:4320452-4320474 TTGTATCCTGAGAGGGAAAGTGG + Intergenic
1003509981 6:6771519-6771541 CTATGTCCAGAGAAGCAAATGGG - Intergenic
1004161289 6:13215472-13215494 CTGTCTCCAGATAGAGAATGAGG + Intronic
1004399558 6:15275770-15275792 CTGTCCCAAGAGAAGGAAAGGGG - Intronic
1004417696 6:15439549-15439571 CTGTCTACAGACAAGGAAAATGG + Intronic
1006016545 6:31085795-31085817 CTGTTTTCAGAGAAGGATATGGG + Intergenic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1006905643 6:37531655-37531677 TTGTCTTCAGAGAGGGAAGCTGG + Intergenic
1008226259 6:48920427-48920449 CCGTTTCAAAAGAGGGAAATTGG - Intergenic
1008248090 6:49203774-49203796 CTGTCAGCAGAGAGGGGAACTGG - Intergenic
1008314051 6:50017199-50017221 CTGGCTCCAGAAAGAAAAATTGG - Intronic
1008883751 6:56409911-56409933 CAGACTCCTGAGAGGGAAAGAGG - Intergenic
1012123068 6:95391129-95391151 CTGTCACTGGAGAGGAAAATAGG + Intergenic
1013585642 6:111576030-111576052 CTGACTCCAAAGAGGGAAGCAGG + Intronic
1014462434 6:121712770-121712792 CTGTCTCTGGAGAGGGGATTGGG + Intergenic
1014550071 6:122779767-122779789 CTGTCTCTAAAGAGGGGAAAGGG + Exonic
1014554493 6:122829532-122829554 CTTCCTCCAGGGAGGGAAAAAGG - Intergenic
1015461885 6:133500830-133500852 CAGTCACCAGAGGGGAAAATGGG - Intronic
1017064807 6:150518952-150518974 CTGTCTCCAAATAGGGAACAGGG + Intergenic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1021794224 7:24237272-24237294 CGGTCTCAAGAAAGGGAAAATGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1028647959 7:93119579-93119601 CTGTCTCCACTGAGTGACATAGG - Intergenic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1032615211 7:133461569-133461591 CTGTCTCCAGAGAGTAATTTGGG + Intronic
1032685568 7:134230868-134230890 TTATCTCCAGAGGGGGAAAATGG + Intronic
1032791074 7:135242880-135242902 TTTTCTCCAGGGAGGGAGATGGG - Intronic
1035270993 7:157719727-157719749 CTGTCTTCAGAGAGGGGTCTGGG - Intronic
1035281000 7:157778134-157778156 CTGTCCCCAGGGAGGAAAACAGG - Intronic
1036694476 8:10965583-10965605 CTGTCTGGAAAGAGGGGAATCGG - Intronic
1036961230 8:13246751-13246773 CTATCTCCAGATAGTTAAATAGG - Intronic
1037552011 8:19983834-19983856 CTGTCTCCAGATAGGTAAGGTGG + Intergenic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038388698 8:27174378-27174400 CTCTCTCCAGAGAGAGAGAGAGG - Intergenic
1038401696 8:27288897-27288919 CCTTCTTCAGAGAGGGAAACTGG - Intronic
1038764322 8:30413390-30413412 CTCCTTCCAGAGAGAGAAATAGG - Intronic
1039821928 8:41142206-41142228 CTGTCACCACAGAGCCAAATGGG + Intergenic
1041728166 8:61037784-61037806 CAGTCACCAGGGAGGCAAATAGG + Intergenic
1045525806 8:102940464-102940486 CTGTCCCCAGGGAGGAAGATGGG - Intronic
1046582116 8:116105778-116105800 CTGTCTCAAAAGAGAGACATGGG + Intergenic
1047194643 8:122710553-122710575 TTGGCTCCAGAGAGGGAAACTGG - Intergenic
1047197987 8:122738888-122738910 CTGTCTGAAGGGAGAGAAATTGG - Intergenic
1047330571 8:123883312-123883334 CTGCCTCAAGAGAAGGAAGTGGG + Intronic
1047672405 8:127162675-127162697 CAGTCTCCAAAGAGGCACATTGG - Intergenic
1048327550 8:133450985-133451007 CTGTCCCCAGAGAGGTGAAGGGG - Intergenic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1051122908 9:13771620-13771642 CTGCCTCCAGAGAGGCAATTTGG + Intergenic
1051167884 9:14285125-14285147 CTGTCTCAAGAAAAGAAAATTGG - Intronic
1052366523 9:27617931-27617953 ATGTCTCCAGTGAAGGAAATGGG - Intergenic
1052834667 9:33241514-33241536 CTGTTTCCAGCTGGGGAAATGGG - Intronic
1055518182 9:77054254-77054276 CTGACTCTAAAGAGGGAGATTGG - Intergenic
1056728476 9:89142999-89143021 CAGACTCAAGAGAGGGATATTGG + Intronic
1057212462 9:93207564-93207586 CTGTCTCCAGTGAGTGTATTTGG + Intronic
1058620891 9:106881439-106881461 TTTTTTCCAGATAGGGAAATTGG - Intronic
1059015752 9:110513970-110513992 GTGTCTGCAGAGAGGGATACAGG - Exonic
1060112002 9:120913258-120913280 CTGTCTCCAGAGCGGCAGACAGG - Intronic
1060804010 9:126563704-126563726 CTCTGTACAGAGAGGGAAACAGG - Intergenic
1061400218 9:130364499-130364521 ATGTTTCCACCGAGGGAAATTGG - Intronic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1186129592 X:6452210-6452232 CTACCTCCAGAGAGGGAAGATGG - Intergenic
1187361022 X:18627840-18627862 CAATATCGAGAGAGGGAAATTGG + Intronic
1188514962 X:30975402-30975424 CTATCTCCAGAGAGGGAAGGAGG + Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1189275814 X:39785202-39785224 CTGTCTCCAGTGAGTGCAGTAGG - Intergenic
1189498442 X:41530640-41530662 CTGTACCCAGAGAGGGAAGGTGG + Intronic
1190751513 X:53366067-53366089 CAGTTTCCATAGTGGGAAATAGG + Intergenic
1191721027 X:64228933-64228955 CTGAGTCCAGAGAGGGTAAGGGG + Intronic
1191841314 X:65515329-65515351 GTGTCTACAGACAGGGAAATAGG - Intronic
1192057228 X:67785290-67785312 ATGACACCAGAGAGGGAAAATGG + Intergenic
1193270879 X:79529787-79529809 CAGCTTCCAGAGAGGGAAACTGG - Intergenic
1195688332 X:107604459-107604481 ATGGCTCCAGAGAGGGAGAAAGG - Exonic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1196070754 X:111518905-111518927 CTGTTGCCAGAGTGGGAAAATGG - Intergenic
1197921366 X:131598041-131598063 CTGCCTGCAGAAAGGGAAACTGG + Intergenic
1198279744 X:135130028-135130050 ATGTCTCCAGGGAGGTAAAATGG - Intergenic
1198291213 X:135242486-135242508 ATGTCTCCAGGGAGGTAAAATGG + Intergenic
1198766422 X:140084528-140084550 GTGTCGTCAGTGAGGGAAATGGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1200827542 Y:7659764-7659786 GTGTGTCCAGAGAGGGAATGTGG + Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201612430 Y:15858196-15858218 CTACCTCCAGAGAGGGAAGATGG - Intergenic