ID: 998099374

View in Genome Browser
Species Human (GRCh38)
Location 5:139419372-139419394
Sequence CTCCAGAGAGGGAAATAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998099364_998099374 6 Left 998099364 5:139419343-139419365 CCAGTGGCAGATGCTATCATCCC 0: 1
1: 0
2: 2
3: 12
4: 135
Right 998099374 5:139419372-139419394 CTCCAGAGAGGGAAATAGGGGGG 0: 1
1: 0
2: 3
3: 23
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998099374 Original CRISPR CTCCAGAGAGGGAAATAGGG GGG Intronic
900351090 1:2234959-2234981 CTCCAGAGCGGGTGGTAGGGCGG + Intronic
900624854 1:3603414-3603436 CTCCACAGAGGCAAATTCGGGGG + Intronic
901096415 1:6683852-6683874 ATGCAGAGATGGAAATATGGAGG - Intronic
902393260 1:16118643-16118665 TTCCACAGACAGAAATAGGGAGG + Intergenic
902981269 1:20125029-20125051 CCCCAGGGCGGGAAAGAGGGAGG + Intergenic
905238370 1:36565962-36565984 CTCCAGAGAAAGAAGTGGGGCGG - Intergenic
906382139 1:45339710-45339732 CTCCAGAAAGTGAAAGAGGCGGG - Exonic
909030851 1:70537815-70537837 CACCAAAGGGGGAAATAAGGAGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
911715981 1:101133609-101133631 ATCCAGAGACTGAAATAGGTAGG + Intergenic
912036729 1:105325448-105325470 CTACAGACAGTGAAATAAGGAGG - Intergenic
912481476 1:109984994-109985016 CGCCAGAGGGGGAAAGAGGCGGG + Exonic
914717937 1:150267203-150267225 CTGCAGGGAGGGAGATGGGGAGG + Intronic
916523389 1:165586346-165586368 TTCCAGAAAGGGAAACAGGAAGG - Intergenic
918636588 1:186781940-186781962 ACCCAGAGAGGGAAACTGGGAGG - Intergenic
919032848 1:192267057-192267079 CTCTAGAGTGGAAAATAGGTAGG - Intergenic
919458620 1:197849234-197849256 CTCTAGGGAGGGAAAGAGGGTGG + Intergenic
920675537 1:208035999-208036021 CTCCAGAGAGGGTAACAAGAGGG + Intronic
920824783 1:209415155-209415177 AGCCAGAGAGGGAAAAAGAGGGG - Intergenic
920882184 1:209890275-209890297 ATCCAGAGAGGAAAAGAAGGTGG + Intergenic
921339155 1:214117236-214117258 GTGCAGAGAGTGAAAGAGGGAGG + Intergenic
922216878 1:223526978-223527000 CTCCAGAGAGGGTAAGAGACAGG + Intergenic
922462872 1:225826622-225826644 ATCCAGAGAGGGAGATAGATTGG + Intronic
923278358 1:232417931-232417953 CTCCAGTGAGGGAAGGAGGGAGG - Intronic
924690087 1:246339817-246339839 CTCCTGAGAGGGAACAAGAGAGG - Intronic
1063037373 10:2299785-2299807 CTCCAGAGAGAGGGCTAGGGTGG + Intergenic
1063061231 10:2555595-2555617 CTCCAGAGAAAGAACTTGGGAGG - Intergenic
1067455807 10:46418638-46418660 CTCCAGAGAGCGAAAGACGATGG - Intergenic
1067631393 10:47966001-47966023 CTCCAGAGAGCGAAAGACGATGG + Intergenic
1069004799 10:63305512-63305534 CTCCAGAGAGAGAGAGAGAGAGG - Intronic
1069325680 10:67228950-67228972 CTTCATAGAGTGAATTAGGGAGG - Intronic
1069868904 10:71521321-71521343 CCCAAGAGAGGGAAATGGTGTGG + Intronic
1070156232 10:73837288-73837310 GGCCTGAGAGGGAAGTAGGGAGG - Intronic
1071822354 10:89291363-89291385 CTGGAGACTGGGAAATAGGGTGG - Intronic
1072911157 10:99502534-99502556 CTCTAGAGAAGGAAACTGGGGGG + Intergenic
1073083996 10:100876857-100876879 ATCCTTAGAGGGAAGTAGGGAGG + Intergenic
1073363443 10:102918295-102918317 CTCGCGGGAGGGAAAGAGGGAGG - Exonic
1075473512 10:122712201-122712223 CTCAGGAGAGGGACATGGGGAGG + Intergenic
1076287134 10:129311359-129311381 CACCAGAGAGGGAGCTGGGGAGG + Intergenic
1077316581 11:1922031-1922053 CCACAGGGAGGGAAATGGGGGGG + Intronic
1077909840 11:6564202-6564224 GTGCAGAGAGGGACAGAGGGAGG - Intronic
1077981328 11:7303429-7303451 TGCCAGAGAGGGGAATGGGGTGG - Intronic
1078484216 11:11706775-11706797 AGCCAGTGAGGGAAATAGGCTGG + Intergenic
1080429369 11:32184494-32184516 TTTCAGAGAGGGAGATAGAGAGG - Intergenic
1080855925 11:36111544-36111566 TTCCAGAGAGGAAAACAAGGTGG - Intronic
1080911427 11:36603496-36603518 TTCCAAAGAGGTATATAGGGAGG + Intronic
1081720616 11:45285948-45285970 CTGCAGAGGGGGAACTGGGGTGG - Intronic
1083174563 11:60941393-60941415 CTCCAGAGAGGGAAAGGAGCTGG - Intronic
1083235641 11:61349181-61349203 CTTCAGGGGAGGAAATAGGGTGG - Exonic
1088051956 11:105527403-105527425 CACAAGAGGGGGAAATTGGGAGG - Intergenic
1088489119 11:110369912-110369934 ATGAAGAGAGGGAAATAGGAAGG - Intergenic
1089784928 11:120901050-120901072 CTCCAGAGAAAGAAGTAGAGGGG - Intronic
1090023211 11:123145914-123145936 CTCCAGGGAGGGCTATAGGTGGG - Intronic
1092033745 12:5312128-5312150 CTGCAGAGAGGTAAATAGTCTGG + Intergenic
1093594591 12:20945546-20945568 CTCCAGTGAAGGAAGCAGGGTGG - Intergenic
1096191283 12:49621911-49621933 CTCCAGAGAGGGGAAGACGATGG + Intronic
1096456513 12:51791844-51791866 CTCCAGCTTGGGCAATAGGGAGG + Intronic
1096957162 12:55538289-55538311 CTTCATAGAGTGAATTAGGGAGG - Intergenic
1096998751 12:55858088-55858110 CAACAGAGAGAGAAATAAGGAGG + Intergenic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1099899357 12:88688795-88688817 TTGCAGAGAGGGAAACAGAGAGG + Intergenic
1100273559 12:93049212-93049234 GTCCAGAGAGGGAAGAATGGTGG - Intergenic
1100290691 12:93211746-93211768 CTTCATAGAGTGAATTAGGGAGG + Intergenic
1102171246 12:110844109-110844131 TTCCAGAGAGGGCTAGAGGGAGG + Intergenic
1102946559 12:116994491-116994513 CTCCAGATAGAGAAACTGGGTGG - Intronic
1104436020 12:128757228-128757250 CTCCAGAGAGGGGAAGGAGGGGG + Intergenic
1104592738 12:130097732-130097754 CTCCAGACAGGGGAAGAGAGAGG + Intergenic
1108196845 13:48003434-48003456 CTCCAGAGACTGAGATGGGGGGG + Intergenic
1108365874 13:49712044-49712066 TTCCAGAGTGGGAAATGGGCTGG - Intronic
1108538820 13:51416215-51416237 CACCAGAGAGGAAAATAGTGTGG + Intronic
1108556266 13:51595870-51595892 CTCCAGAGAGGGAATCAGGAAGG - Intronic
1108749781 13:53436878-53436900 CTCCAGAAATGCAAATAGGGTGG + Intergenic
1110930763 13:81213086-81213108 ATCCAGAGAGGCAAGTAGAGAGG - Intergenic
1113226401 13:108164570-108164592 CTCCAGAAAGTGCTATAGGGTGG - Intergenic
1114368584 14:22058686-22058708 CTGCAGAGAGAGAAAGAGAGGGG - Intergenic
1115433673 14:33349275-33349297 GTCCAGAAATGGAAATAGAGGGG + Intronic
1116111448 14:40590559-40590581 CTCCAGGGAGGGAAGAAGGATGG + Intergenic
1116227813 14:42174360-42174382 CTCCAGAGAGGTTAATGTGGAGG - Intergenic
1117021869 14:51579202-51579224 ATCCAGGGAGGGAAATTGGGTGG - Intronic
1117648657 14:57879618-57879640 CTCCTGGCAGGGAAATATGGTGG - Intronic
1118496681 14:66314459-66314481 GTTCAGAAAGGGAAATAAGGAGG - Intergenic
1118729855 14:68658613-68658635 ATCCACAGAGGGAAACATGGAGG + Intronic
1118769997 14:68936402-68936424 CTCCAGGGAGAGAAATGGGAAGG + Intronic
1119529270 14:75348265-75348287 CTCCAGAAATGGAAATGAGGAGG - Intergenic
1119995620 14:79250410-79250432 CCTCAGAGAAGGAAAGAGGGAGG + Intronic
1121671433 14:95713761-95713783 CTCCAGGCAGGGAAGAAGGGTGG - Intronic
1122356996 14:101128956-101128978 CTCCAGAGAGGCAAAGGCGGAGG + Intergenic
1122524548 14:102371483-102371505 CCCCAGATAGGGAAATAGCATGG + Intronic
1202836055 14_GL000009v2_random:77840-77862 CTCCTTAGAGAGAAGTAGGGTGG - Intergenic
1124354484 15:28984762-28984784 CTCCAGAGATGGCAGTGGGGTGG - Intronic
1126136503 15:45397378-45397400 CTCCAGAGAGGGACGGAGGCTGG + Intronic
1127267854 15:57376147-57376169 GTCGAGAGCGCGAAATAGGGAGG + Intronic
1127698392 15:61473726-61473748 CTTCAGAGAGGGAGGTAAGGGGG + Intergenic
1127775149 15:62258719-62258741 CTCAGGAGAGAGAAACAGGGTGG - Intergenic
1128247668 15:66144041-66144063 CTCCAGGTGGGGATATAGGGAGG + Intronic
1129007612 15:72387305-72387327 CTCTGGAGAGGGATATTGGGTGG + Intergenic
1129261637 15:74371797-74371819 CCTCAGAGAAAGAAATAGGGTGG - Intergenic
1129742987 15:77999121-77999143 ATCCAGAGAGGGGAAGAAGGTGG - Intronic
1129842491 15:78752318-78752340 ATCCAGAGAGGGGAAGATGGTGG + Intergenic
1129852825 15:78804345-78804367 CTGCAGAGAGGGAAAAGAGGGGG - Intronic
1129888018 15:79052234-79052256 CTCCAGAGAGGGGAGTAGGGTGG - Intronic
1129928783 15:79390596-79390618 CTCCATAGAATGAATTAGGGAGG + Intronic
1130813739 15:87408639-87408661 ATCCAGAAAGGGAGATAGTGTGG - Intergenic
1130936671 15:88476861-88476883 ATCCAGAGAAGTAAACAGGGAGG - Intronic
1131132003 15:89906198-89906220 CTCCAGGGAGGCAAATAGCCTGG - Intronic
1132234255 15:100207206-100207228 TTGGAGAGAGGGAAAGAGGGAGG - Intronic
1133880784 16:9779671-9779693 TTCCATAGAGGGTAATAGGGTGG + Intronic
1134366835 16:13586661-13586683 CCCCAGAGAGGAAAGAAGGGAGG - Intergenic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1137314182 16:47299418-47299440 TTCCAAGGTGGGAAATAGGGGGG + Intronic
1138070926 16:53992284-53992306 CTGCAGAAATGGAAATAGAGTGG + Intronic
1139684630 16:68593405-68593427 CTCCAGAGAGGGCAGAAGGCTGG + Intergenic
1140464976 16:75174287-75174309 CTTCAGAGAGGGAAATCAGCGGG + Intergenic
1140789509 16:78377655-78377677 TTGCATAGAGGGAAATAGGAAGG + Intronic
1141554387 16:84827334-84827356 CTCGAGGGAGGGAAGTCGGGCGG - Intronic
1142179383 16:88660044-88660066 CTTCAGGGAGGGAAAGGGGGCGG - Intronic
1142359471 16:89619518-89619540 CTGCAGAGAGGGGAGCAGGGGGG - Intronic
1142472714 17:172235-172257 CTGCTGAGAGGGAAAGAGAGGGG - Intronic
1143246831 17:5493642-5493664 CTCCAGCCAGGGCAACAGGGCGG - Intergenic
1143898661 17:10156795-10156817 GCCCAGAGAGGGGAAAAGGGAGG - Intronic
1146493548 17:33300130-33300152 CTCCAGGGAGGAAAACTGGGTGG - Intronic
1147880509 17:43650612-43650634 CCCCAGAGAGGGAAAAAGAAGGG + Intronic
1147934424 17:44003621-44003643 CTCCAGCCTGGGCAATAGGGTGG + Intronic
1148366978 17:47062761-47062783 CTTCGGGGAGGGAAATTGGGAGG + Intergenic
1148793006 17:50184063-50184085 CTCCAAAGAAGGAAATTAGGAGG + Exonic
1149923400 17:60679286-60679308 CACCAGAAAGGGAAAAAAGGAGG - Intronic
1150207572 17:63420573-63420595 CTCCGGAGAGGGGAAGGGGGAGG - Exonic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151016182 17:70555853-70555875 CTGGAGAGAGGGAATGAGGGAGG + Intergenic
1153190580 18:2533393-2533415 CTCTAGGGAGGGAAGAAGGGAGG + Intergenic
1154018339 18:10639618-10639640 CTCCAGAAAGGGACATTTGGGGG - Intergenic
1154186534 18:12189972-12189994 CTCCAGAAAGGGACATTTGGGGG + Intergenic
1156536656 18:37870969-37870991 CTCCAGGGAGGGCTATAGGAAGG + Intergenic
1157801463 18:50625012-50625034 CCCCAGAGAGTGAATTAGAGTGG - Intronic
1158478883 18:57803393-57803415 CCCTAGGGAGGGAAAAAGGGAGG - Intergenic
1159834561 18:73322977-73322999 GTCCAGAGAGGGGAAGAGGTAGG + Intergenic
1161514291 19:4688215-4688237 CTCCAGAGACTGAGATGGGGGGG - Intronic
1161806619 19:6447408-6447430 CTCCAGAGGTTGAAGTAGGGAGG - Intronic
1162335521 19:10057888-10057910 GTCCAGAGAGGGGAAGAGGGTGG + Intergenic
1162841061 19:13356732-13356754 CTCCTGAGAGGGAAAGAGACTGG - Intronic
1168254981 19:55160242-55160264 CTCTAGAGAGGGAAAGAGGGTGG + Intronic
1202636580 1_KI270706v1_random:49522-49544 CTCCTTAGAGAGAAGTAGGGTGG + Intergenic
925278417 2:2666641-2666663 CTCCAGCCTGGGCAATAGGGCGG - Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
926895258 2:17679936-17679958 GTTCAGGGAGGGAAATAGGAAGG - Intronic
926930317 2:18031532-18031554 GTGCAGAGAGGGAGAGAGGGAGG - Intronic
927361759 2:22243515-22243537 CTTCTGAGATGGAAATATGGTGG - Intergenic
928337122 2:30407686-30407708 CTGCAGAGTGGGAAATGGGAGGG - Intergenic
929050523 2:37832793-37832815 CACTGGAGAGGTAAATAGGGAGG + Intergenic
929473902 2:42225699-42225721 CTGCAGGGAGGGAAGAAGGGTGG - Intronic
929496304 2:42447143-42447165 CTCCAGGGAGGGGAATTGGGTGG - Intronic
929898169 2:45979373-45979395 CTTCAGGGAGGGAGACAGGGAGG - Intronic
930716307 2:54596815-54596837 CTACAGAGAGGCAAATGGAGAGG - Intronic
932297457 2:70638904-70638926 CTCTAGAGAGGGGAACAGGTAGG + Intronic
933120180 2:78526601-78526623 CTCCAGGGAGGGCAGAAGGGTGG - Intergenic
933647266 2:84822853-84822875 GTCCAGAGAGGTAAACACGGAGG - Intronic
933731007 2:85456289-85456311 CGCCGGTGAGGGAAACAGGGTGG + Intergenic
934730913 2:96656869-96656891 CTCTAGATAGGGAAATGGGGTGG - Intergenic
936523762 2:113228913-113228935 CTCCAGAAAGAGAGATAAGGAGG - Intronic
936686988 2:114838823-114838845 ATCCAGAGAGGTAAATGGTGTGG - Intronic
937130923 2:119512426-119512448 CTCCAGCCTGGGAAATAGAGCGG - Intronic
937201984 2:120209752-120209774 CTGCAGAGTGGGAGATGGGGTGG + Intergenic
937406381 2:121633066-121633088 CTCCAGGGAAAGAAATTGGGTGG + Intronic
939026152 2:137015801-137015823 CTTCTGAGAGAGAAATAGAGTGG - Intronic
940172076 2:150839892-150839914 CTCCATAGAATGAATTAGGGAGG + Intergenic
941457015 2:165721251-165721273 ATCCAGGGAGGGAAAAGGGGTGG - Intergenic
941698220 2:168576029-168576051 GTCCAGGCAGGGACATAGGGAGG + Intronic
941698410 2:168577692-168577714 GTCCAGACAGGGGCATAGGGAGG + Intronic
946488591 2:220125884-220125906 CTGTAGAGAGGAAAATAGGGCGG + Intergenic
947049948 2:226031079-226031101 CTGCAGAGAGGGGAGGAGGGAGG - Intergenic
947588288 2:231370416-231370438 CTCCACAGAGGGAAGTGGGGAGG - Intronic
1168803796 20:661481-661503 CTACAGAGAGGAAAATGGAGTGG + Intronic
1171170185 20:23008936-23008958 CTCCAGGGAGGGAATCAGGGTGG + Intergenic
1171882716 20:30630453-30630475 CTCCTTAGAGAGAAGTAGGGTGG + Intergenic
1172134994 20:32680908-32680930 CATCAGAGAGGGAAAGAGGAAGG - Intergenic
1173583816 20:44166752-44166774 ATCCACAGAGGGAGAGAGGGAGG + Intronic
1174436571 20:50510942-50510964 CTCCAGAAAAGGAAATAGTGGGG - Intronic
1179501639 21:41812963-41812985 CCACAGAGAGGGAGACAGGGAGG + Intronic
1180364290 22:11924791-11924813 CTCCTTAGAGAGAAGTAGGGTGG - Intergenic
1180732667 22:17993790-17993812 GTGAAGAGAGGGAAATATGGAGG + Intronic
1181517416 22:23423112-23423134 GTGAAGAGAGGGAAATATGGAGG + Intergenic
1182155178 22:28064832-28064854 CTCCAGGGAGGAAAATTAGGTGG + Intronic
1182672632 22:32009984-32010006 CTCCAGAGAGGGAGAAAGAAAGG + Intergenic
1183619738 22:38965412-38965434 CTCCAGAGAGGAAAGAAGAGAGG - Intronic
1183625534 22:38999253-38999275 CTCCTGAGAGGGAGGGAGGGAGG - Intergenic
1184082741 22:42235854-42235876 CCTGAGAGAGGGAAAGAGGGTGG - Intronic
1184631081 22:45780533-45780555 CTACAGAGGGGGAAACAGGCTGG - Intronic
1184903627 22:47464079-47464101 CCCTGGAGAGGGAAATACGGTGG - Intronic
1184965102 22:47965827-47965849 ATCCAGGGAGGGAAACAGAGGGG - Intergenic
949538501 3:5013823-5013845 GTGCAGAGAGGGAAAGAGAGGGG - Intergenic
950681494 3:14588359-14588381 GTCCAGAGAAGGAGAGAGGGTGG - Intergenic
950700902 3:14745265-14745287 CCACAGGGAGGGAACTAGGGAGG + Intronic
951059941 3:18194257-18194279 TTCTAGAGAGGGAAACTGGGTGG - Intronic
951194834 3:19812580-19812602 ATCCAGAAAGAGAAATAGTGGGG + Intergenic
953040463 3:39251259-39251281 CACCTGTGAGGGAAAAAGGGAGG - Intergenic
953589367 3:44236740-44236762 ATTCAGAGAGGGAATTATGGTGG - Intergenic
954536308 3:51361831-51361853 AGCAAGAGTGGGAAATAGGGAGG - Intronic
954574091 3:51665350-51665372 CTCCAAAGATGGAAATGGGCTGG - Exonic
954579277 3:51694427-51694449 GGCCAAAGAGGGAAAGAGGGAGG + Intronic
954613541 3:51958350-51958372 CTGGAGAGAGGGATATAGAGGGG + Intronic
956233889 3:67044873-67044895 GTCAAAAGAGAGAAATAGGGAGG + Intergenic
956302953 3:67792513-67792535 CTCCAGACTGGGTAACAGGGTGG - Intergenic
957650844 3:83001093-83001115 TTACAGAGAGGGAAAGAGAGAGG + Intergenic
959108524 3:102094096-102094118 CTTCACAGAGTGAAATGGGGTGG - Intergenic
961611859 3:128145882-128145904 CTCCAGGGAGGGGAACAGGTTGG - Intronic
961982954 3:131100750-131100772 CTTCATAGAGTGAATTAGGGAGG + Intronic
962897476 3:139729281-139729303 CTCCAGAGAGGACAAAAGTGAGG + Intergenic
964030345 3:152131250-152131272 CTCAAAAGGGGGAAATTGGGAGG + Intergenic
965014479 3:163139704-163139726 CTCCAGAGCTGGAAAATGGGTGG + Intergenic
965302874 3:167024865-167024887 TTTCAGAGAGGGAAATATGAAGG + Intergenic
966591058 3:181683397-181683419 TTCCAGGAAGGGAACTAGGGAGG - Intergenic
966911954 3:184564710-184564732 CTCCAGAGAGGGAAGGAATGGGG + Intronic
966919478 3:184602433-184602455 CTGGAGAGAGGGAAAGAGTGAGG - Intronic
968940110 4:3633330-3633352 CTCCAGACATGGAAGGAGGGAGG - Intergenic
969118218 4:4887772-4887794 CTCCAGAGAGGAAACCAGAGAGG + Intergenic
970191598 4:13523707-13523729 CTGCCGAGAGGGAAGTGGGGTGG + Intergenic
970231455 4:13915458-13915480 CACCAGAGAGGACAAAAGGGAGG - Intergenic
970522374 4:16898754-16898776 CTCCAGAGAGGGAGGGAGGTTGG + Exonic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
973366391 4:49212892-49212914 CTCCTTAGAGAGAAGTAGGGTGG + Intergenic
973394218 4:49579542-49579564 CTCCTTAGAGAGAAGTAGGGTGG - Intergenic
975665343 4:76729289-76729311 CTCAAGAGAGGGAGAGAGGCTGG - Intronic
977093156 4:92704772-92704794 CCCCAGAGAGGGAGGGAGGGAGG - Intronic
979225791 4:118282887-118282909 CTCCAGAGTGGTAAACAGGCTGG + Exonic
981874961 4:149530871-149530893 CTCCAGGTAGAGAAATAGAGAGG + Intergenic
983152324 4:164300158-164300180 CTACAGTGATGGAAGTAGGGAGG - Intronic
1202763899 4_GL000008v2_random:135394-135416 CTCCTTAGAGAGAAGTAGGGTGG + Intergenic
985790359 5:1923692-1923714 ATCCAGGGAAGGAAAGAGGGAGG - Intergenic
986378229 5:7155497-7155519 CTCCACAGAGTGAATTAGGGAGG + Intergenic
986636004 5:9823430-9823452 CTCCAGACAGGAAGAGAGGGAGG + Intergenic
987623799 5:20371126-20371148 CTCTGGAGAGGGGAAGAGGGAGG + Intronic
988435612 5:31171335-31171357 CTCCAAACTGGGATATAGGGAGG - Intergenic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989757965 5:44979032-44979054 CTTCAGAGAATGAATTAGGGAGG - Intergenic
990243836 5:53842370-53842392 CTTCATAGAGTGATATAGGGAGG - Intergenic
992749584 5:79849838-79849860 CTCCAGAGAGGCATGTGGGGGGG - Intergenic
993832095 5:92772584-92772606 ATCAAGAGAGGGAAAAAGGAAGG + Intergenic
994804960 5:104433905-104433927 CTCTAGGGATAGAAATAGGGTGG + Intergenic
995023841 5:107396909-107396931 CTGCAGAGAGGAAACTAGGCTGG + Intronic
996036130 5:118761033-118761055 CCCCAGGAAGAGAAATAGGGTGG + Intergenic
997165707 5:131658705-131658727 CTCCTTAGAGAGAAATGGGGTGG + Intronic
998099374 5:139419372-139419394 CTCCAGAGAGGGAAATAGGGGGG + Intronic
999977039 5:156922086-156922108 CTCCTGAGAGGTAAGGAGGGAGG - Exonic
1000174168 5:158734494-158734516 CAACAGAGAGGGTAACAGGGAGG + Intronic
1001953903 5:175834967-175834989 CTCCAGAGAGGGACAACAGGAGG + Intronic
1001995233 5:176152212-176152234 CTCCAGAGAAGGATATAGACAGG + Intergenic
1002057303 5:176605877-176605899 TTCCAGAGAAGGAAACAGGCAGG - Intronic
1002563769 5:180099063-180099085 CTCCAGGGAGGGAGCTGGGGTGG - Intergenic
1003509979 6:6771515-6771537 GTCCAGAGAAGCAAATGGGGTGG - Intergenic
1005996113 6:30932378-30932400 CTACAGACAGGGAAATGGAGAGG + Intergenic
1006783313 6:36647516-36647538 CTCAAGAGAGGGAAAAAGGAAGG + Intergenic
1007706754 6:43795769-43795791 CTTCAGAGAGGGAGAGAGGATGG - Intergenic
1008336768 6:50315680-50315702 CACCATAGAGGCAAATATGGAGG - Intergenic
1010008699 6:71025722-71025744 CTTCATAGAGTGAATTAGGGAGG + Intergenic
1010903407 6:81455706-81455728 CTACACAGTGGGTAATAGGGAGG - Intergenic
1010936064 6:81863221-81863243 CACCATAGAGGGAAATAGCCTGG + Intergenic
1012001384 6:93659332-93659354 CTCCTGAGAGTGAAATAGATGGG + Intergenic
1016622914 6:146133568-146133590 CTCCTGAGAGGGAAAAAGATGGG - Intronic
1017021072 6:150141227-150141249 CTGCGGAGATTGAAATAGGGTGG - Intergenic
1017205102 6:151796406-151796428 CTCCAGAGAGGGAAAATTGGTGG + Intronic
1017727949 6:157288557-157288579 CTCCAGAGTAGGAAACATGGTGG + Intergenic
1017870270 6:158480998-158481020 CTCCAGAGAGGCAGAGAGAGAGG - Intronic
1019516984 7:1444502-1444524 CCCCAGAGAAGGAAACAGGCTGG + Intronic
1020223103 7:6256587-6256609 CTCCTGAGAAGGAAAAAGTGGGG + Intronic
1020628124 7:10608072-10608094 CTGCTGAGAAGGAATTAGGGAGG - Intergenic
1021308012 7:19055025-19055047 CTCCAGAGAGGTAAATAAGGAGG + Intronic
1021466273 7:20947313-20947335 CTTCATAGAGTGAATTAGGGAGG - Intergenic
1022169278 7:27808203-27808225 ATACAGAGAGGGAAAGAGAGGGG - Intronic
1024187555 7:46968134-46968156 TGGGAGAGAGGGAAATAGGGAGG + Intergenic
1025840067 7:65138199-65138221 TTGCAGAGAGAGAAATAGGAAGG + Intergenic
1025882996 7:65557765-65557787 TTGCAGAGAGAGAAATAGGAAGG - Intergenic
1025890448 7:65644840-65644862 TTGCAGAGAGAGAAATAGGAAGG + Intergenic
1026858126 7:73768475-73768497 CTCAAGGGAGGGAAAGAGGGAGG - Intergenic
1029778260 7:102701965-102701987 CTTCAGAGAGAGAAAGAGAGAGG + Intergenic
1030927030 7:115470609-115470631 CTACAGAAAGGAAATTAGGGAGG - Intergenic
1032209581 7:129901310-129901332 ATAGAGAGAGGCAAATAGGGTGG - Intronic
1032440363 7:131938165-131938187 ATACAGAGAGGGAGATAGGTGGG + Intergenic
1032679535 7:134167705-134167727 CTCCAGAGGTGGAAATACGCTGG - Intronic
1033510816 7:142058537-142058559 CGCCAGAGTGGGAGATAGGCTGG + Intronic
1034191828 7:149219098-149219120 CTCCAGGGAGGGAAAGGGGCTGG - Intronic
1034395629 7:150822529-150822551 CTGGAGAGAGGGAGAAAGGGAGG + Intergenic
1035174004 7:157037682-157037704 GTCCAGACAGGGGAAGAGGGAGG + Intergenic
1036644360 8:10602489-10602511 CTCCGGAGAGGCAATTAGGGTGG - Intergenic
1037272082 8:17141394-17141416 AGCCAGTGAGGGACATAGGGAGG - Intergenic
1037631673 8:20663069-20663091 AACCAGAGAGTGAAATAAGGAGG - Intergenic
1038366948 8:26946125-26946147 CTTCATAGAAGGAATTAGGGAGG + Intergenic
1039321435 8:36435965-36435987 CTCCAGAGAGTTAGATAGGTAGG - Intergenic
1039563124 8:38528950-38528972 CCCCAGAGCGGGAACCAGGGTGG + Intergenic
1039915883 8:41859972-41859994 CTAAAGAAAGGGAAATGGGGAGG + Intronic
1040602996 8:48902911-48902933 CTCCATAGAGCGAAAGAGAGGGG + Intergenic
1041536953 8:58937401-58937423 CTCCTGATAGGGAAAGAGGAAGG + Intronic
1042733740 8:71964838-71964860 CTCCAGAGGAGGAAAAAGCGAGG - Intronic
1047194642 8:122710549-122710571 CTCCAGAGAGGGAAACTGGATGG - Intergenic
1049164850 8:141119337-141119359 CTCCAGAGTGGGGACAAGGGAGG + Intronic
1049461769 8:142733058-142733080 AACCAGAGACGGCAATAGGGTGG - Intronic
1052301022 9:26952663-26952685 CTCCAGAGAGGAAAACTGGGTGG - Intronic
1052346860 9:27418317-27418339 CTTCATAGAGTGAATTAGGGAGG - Intronic
1054450647 9:65401959-65401981 CTCCAGACATGGAAGGAGGGAGG + Intergenic
1055238043 9:74148120-74148142 CTCTAGAGTGGGAATTTGGGTGG + Intergenic
1055928793 9:81538581-81538603 GTCCAGGGAAGGAAACAGGGTGG + Intergenic
1056509074 9:87285612-87285634 CTCCAGAGAGGGCATGAGAGGGG - Intergenic
1056994809 9:91445806-91445828 CTCCAGTGACTGAAATCGGGGGG + Intergenic
1058619208 9:106864630-106864652 CTACAGAGAGGGAGGGAGGGAGG + Intronic
1058967045 9:110048458-110048480 CTGGAGAGAGGGAAAGACGGAGG - Intronic
1203544647 Un_KI270743v1:120267-120289 CTCCTTAGAGAGAAGTAGGGTGG + Intergenic
1186082828 X:5951952-5951974 CTCCAGAGTGGGAAAAAAGTTGG + Intronic
1186268476 X:7858466-7858488 ATCCAGAGAGGAGAATAGGGAGG - Intergenic
1186983027 X:14978542-14978564 TTCAAGAGAGGGAATAAGGGAGG + Intergenic
1187733698 X:22282580-22282602 AGCCAGAGAGGGAAACAGGCCGG - Intergenic
1191055600 X:56236755-56236777 CTCCAGCGAGGCAAAATGGGTGG - Intronic
1191150666 X:57218708-57218730 CTTCAGAGAATGAATTAGGGAGG + Intergenic
1192244303 X:69360217-69360239 CTCCAGATATGGAGAAAGGGTGG - Intergenic
1192797089 X:74432934-74432956 CTTTAGGGAGGGAAACAGGGTGG - Intronic
1195010638 X:100729922-100729944 TCCCAGAGATGGGAATAGGGAGG + Intronic
1195130096 X:101842784-101842806 CTCCAGAGAGAAAAATGAGGCGG - Exonic
1195941955 X:110174385-110174407 CCTGAGAGAGGGAAAGAGGGAGG - Exonic
1196082434 X:111648097-111648119 CTCCAGCCAGGGCAACAGGGTGG - Intergenic
1196320676 X:114335857-114335879 CTCCATACAGGAAAAAAGGGGGG + Intergenic
1196884127 X:120226733-120226755 CTCCAGTGAGGGCAACAGAGTGG + Intergenic
1198417412 X:136434628-136434650 TTCCAGAGAGGGGCAGAGGGAGG - Intergenic
1199221056 X:145316134-145316156 CTCCAAATAAAGAAATAGGGAGG + Intergenic
1199227150 X:145390820-145390842 CTTCAGAGAGTGAGTTAGGGAGG + Intergenic
1199398833 X:147373074-147373096 CTTCATAGAGTGAATTAGGGAGG + Intergenic