ID: 998100215

View in Genome Browser
Species Human (GRCh38)
Location 5:139426649-139426671
Sequence ACTGGGAACCCGAACTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998100215_998100225 3 Left 998100215 5:139426649-139426671 CCCCCTCAGTTCGGGTTCCCAGT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 998100225 5:139426675-139426697 CACAAGTCCCAGGCATGTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 143
998100215_998100228 20 Left 998100215 5:139426649-139426671 CCCCCTCAGTTCGGGTTCCCAGT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 998100228 5:139426692-139426714 TTGGGGAAATGTTCTCCAACTGG 0: 1
1: 0
2: 0
3: 14
4: 190
998100215_998100219 -7 Left 998100215 5:139426649-139426671 CCCCCTCAGTTCGGGTTCCCAGT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 998100219 5:139426665-139426687 TCCCAGTCACCACAAGTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 204
998100215_998100222 1 Left 998100215 5:139426649-139426671 CCCCCTCAGTTCGGGTTCCCAGT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 998100222 5:139426673-139426695 ACCACAAGTCCCAGGCATGTTGG 0: 1
1: 0
2: 0
3: 7
4: 166
998100215_998100224 2 Left 998100215 5:139426649-139426671 CCCCCTCAGTTCGGGTTCCCAGT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 998100224 5:139426674-139426696 CCACAAGTCCCAGGCATGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998100215 Original CRISPR ACTGGGAACCCGAACTGAGG GGG (reversed) Intronic
900169038 1:1257404-1257426 ACTCGGGAGCCGAGCTGAGGGGG - Intronic
905912788 1:41665105-41665127 AATTGGCACCAGAACTGAGGTGG - Intronic
905959988 1:42035612-42035634 ACGGGGGACCCCAGCTGAGGGGG + Intronic
906784690 1:48604348-48604370 ACTGGGAACACGTACCAAGGAGG - Intronic
906943411 1:50275597-50275619 ACTGAGACCCCGCACTGGGGAGG - Intergenic
907627435 1:56043816-56043838 TCTGGGAAGCAGAACTGAGAAGG - Intergenic
911502510 1:98705817-98705839 AGTGGGAACCTGAACTGAAGAGG + Intronic
912697912 1:111855307-111855329 ACTGGGAACTCATACTCAGGAGG - Intronic
915194647 1:154180421-154180443 ACTTTGAACCCCTACTGAGGAGG - Intronic
918402890 1:184181165-184181187 ACAGGGAACCCAAACTGAGGTGG + Intergenic
918470042 1:184862257-184862279 ACTAGGAAGCTGACCTGAGGAGG - Intronic
921910383 1:220542541-220542563 GCTGGGAACCCCTACTGACGTGG + Intronic
1063385576 10:5614242-5614264 ACTGGGAATTGGAACAGAGGAGG + Intergenic
1064293717 10:14058595-14058617 ACTGGGAACCTGATCTAGGGAGG + Intronic
1067474494 10:46556813-46556835 AGTGGGGACCCGGCCTGAGGAGG - Intergenic
1068553798 10:58435450-58435472 TCTGGGAAGCCGAGCTGAGGAGG - Intergenic
1069631864 10:69902123-69902145 ACTGGGAACCCTGGCTGAGCTGG - Intronic
1070745052 10:78928632-78928654 ACTGGGACCCCGGGCTGAGGAGG + Intergenic
1073435375 10:103512993-103513015 ACAGGGAACCAGAAATGAGAAGG - Intronic
1076350171 10:129810243-129810265 ACTGGGAACCCCACCAGAGAGGG - Intergenic
1076833196 10:133007228-133007250 AGTCGGAACCCGATCTGAGATGG + Intergenic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1092349661 12:7745889-7745911 AATGGCAACCCTAACTGAGAAGG - Intronic
1093424518 12:19012809-19012831 ACTGGGAAACCTATCTGAGATGG + Intergenic
1093527162 12:20115719-20115741 ACTGGGAACCCAGGCAGAGGAGG + Intergenic
1097433039 12:59531163-59531185 ACTGGGAACCAGAACACATGGGG - Intergenic
1100185943 12:92140088-92140110 ACTGGGAAGCTAAACTGAGAAGG - Intronic
1101255120 12:102969117-102969139 ACTGGGACACAGAAATGAGGGGG + Intergenic
1102535335 12:113576754-113576776 ACTGGGGGCCTGAGCTGAGGCGG + Intergenic
1102950882 12:117030527-117030549 ACTGGGAACGCAGACTGAAGGGG - Intronic
1105673753 13:22648192-22648214 AGTGGGAATGCCAACTGAGGAGG - Intergenic
1108068573 13:46604253-46604275 TCTGGCAACCCTAACTGGGGTGG + Intronic
1111984277 13:95049901-95049923 AATGGGAACCCAAACTCAGAGGG - Intronic
1112331924 13:98483299-98483321 ACTGTGAACCCAAACTCTGGCGG - Intronic
1122160550 14:99781241-99781263 ACCGGGAAACCCACCTGAGGGGG - Intronic
1127984686 15:64060721-64060743 AGTGGGAACCCGGGCAGAGGAGG - Intronic
1129269014 15:74409790-74409812 CCTGGGAGCCCGGTCTGAGGGGG - Exonic
1131268764 15:90934194-90934216 CCTGGGAACTGGAACTGATGGGG + Intronic
1132262898 15:100441801-100441823 ACTGGGAACACAGACTGGGGGGG - Intronic
1134094925 16:11412940-11412962 CCTTGGAACACGAGCTGAGGAGG + Exonic
1136630796 16:31488296-31488318 ACTGGGAATCCTAGCAGAGGAGG - Intronic
1137729224 16:50677566-50677588 ACCGGGAACCCCAACTGGAGTGG - Intronic
1141956590 16:87376051-87376073 ACTGGCAACTGGAAATGAGGTGG - Intronic
1143021145 17:3917776-3917798 GCTGGGAGCCAGAACTGTGGTGG + Intergenic
1148326803 17:46788004-46788026 ACTGGTCACCTGCACTGAGGTGG - Intronic
1152998847 18:434588-434610 ACTGGCAACCTGAGCTGATGAGG - Intronic
1167062902 19:47161744-47161766 AATGAGAAACCCAACTGAGGAGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
925405344 2:3602365-3602387 GCTGAGAAACAGAACTGAGGAGG - Intronic
926496370 2:13593013-13593035 GCTGGGAACCCCACGTGAGGTGG - Intergenic
926672071 2:15585960-15585982 CCTGGGAATAGGAACTGAGGAGG + Intergenic
927178144 2:20424696-20424718 ACTGTGTACCCGGACTGTGGAGG + Intergenic
932057461 2:68461114-68461136 ACTGGGACCCCCACCTGATGTGG - Exonic
935397474 2:102623094-102623116 ACTGGCAACTAGAACAGAGGGGG - Intronic
937680642 2:124640699-124640721 TCTGGGAACCTTTACTGAGGGGG - Intronic
945103507 2:206286491-206286513 ACTGGAAACCAAAAGTGAGGAGG - Intronic
946885598 2:224219497-224219519 ACTGAGAAGGCGCACTGAGGTGG + Intergenic
1170189754 20:13633542-13633564 ACAGGGAATCCAAATTGAGGGGG + Intronic
1172384218 20:34522188-34522210 ACTGGTGACCACAACTGAGGAGG - Intronic
1173198081 20:40932447-40932469 AGTGGGAACAAGAATTGAGGTGG - Intergenic
1178345284 21:31820734-31820756 ACTGTGATCACCAACTGAGGCGG - Intergenic
1181600933 22:23951593-23951615 CCTGGGAACCCCCACTGGGGAGG + Intergenic
1184792497 22:46708682-46708704 ACAGGGAACCAACACTGAGGTGG + Intronic
954800789 3:53185887-53185909 ACTGAGACCCCGATCTGAGGAGG + Intronic
955795104 3:62628061-62628083 ACTGTGAATCTGAACAGAGGAGG - Intronic
959016192 3:101136619-101136641 ACTGGGAAAGAGAACTCAGGAGG - Intergenic
960638371 3:119805915-119805937 ACTGGAAACCTGAACTGAACAGG - Intronic
966975404 3:185078653-185078675 GGTGTGAACCAGAACTGAGGAGG - Exonic
969578807 4:8051962-8051984 ACAGGGAACCCCAAGTGGGGTGG - Intronic
973735949 4:53871910-53871932 ACTGGGACCCCAAACCAAGGCGG - Intronic
980244707 4:130224152-130224174 ACCCGGGACCTGAACTGAGGTGG - Intergenic
984490045 4:180422435-180422457 ATTGGGAACCAGAACTGTGAGGG + Intergenic
996921401 5:128771737-128771759 ACTGGTCACACTAACTGAGGTGG + Intronic
998100215 5:139426649-139426671 ACTGGGAACCCGAACTGAGGGGG - Intronic
999647549 5:153734227-153734249 ACTGGGTGCCAGAACTGTGGTGG - Intronic
1001214714 5:169845119-169845141 ACTGAGATCCCGAATTCAGGTGG - Intronic
1010223983 6:73472081-73472103 ACTGAGAATAAGAACTGAGGAGG - Intronic
1023633233 7:42183944-42183966 GCTGGGGACCCAACCTGAGGAGG - Intronic
1024634169 7:51273889-51273911 ACTGGGTACGTGAACTGTGGCGG - Intronic
1031845130 7:126796635-126796657 ACTGTGAACCTCAAATGAGGTGG - Intronic
1038725673 8:30080371-30080393 ACTGGAAACCTGAAGTGGGGAGG - Intronic
1040959053 8:53011565-53011587 AGGGGGAACCAGAACTGAGCTGG + Intergenic
1045269436 8:100649540-100649562 GCTGGGAACCCGACCTGCGGCGG + Exonic
1046050757 8:109019487-109019509 AATGGGCATCTGAACTGAGGAGG + Intergenic
1047768409 8:128009697-128009719 AATGGGAACCTGAGCTGAGCAGG + Intergenic
1048519761 8:135142536-135142558 AGTGTGATCCTGAACTGAGGTGG - Intergenic
1056749656 9:89338735-89338757 ACTGGGAAGCCAAAATGAAGAGG - Intronic
1057210361 9:93198031-93198053 ACTGGGAAACTTTACTGAGGGGG - Intronic
1057877173 9:98767014-98767036 ACTAGGAACCCGCACTCTGGGGG + Intronic
1061829313 9:133280699-133280721 ACTGGGAATTCGAACTAGGGTGG + Intergenic
1187554009 X:20333884-20333906 AGTGGGAAGCCAAGCTGAGGTGG + Intergenic
1192259595 X:69496696-69496718 AGAGGGAACCAGAGCTGAGGGGG - Intergenic
1192575272 X:72238747-72238769 CCTGGGGACCCGAACTGTTGAGG - Intronic
1195736869 X:108020754-108020776 ATTGAGTACCAGAACTGAGGAGG - Intergenic
1196827353 X:119751319-119751341 AGTGGGAACCCAAGCAGAGGAGG + Intergenic
1201525725 Y:14931867-14931889 AATGTTAACCAGAACTGAGGAGG - Intergenic