ID: 998101977

View in Genome Browser
Species Human (GRCh38)
Location 5:139442057-139442079
Sequence CAGTTTTAGTGGCTGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998101977_998101983 12 Left 998101977 5:139442057-139442079 CCTGAATCCAGCCACTAAAACTG 0: 1
1: 0
2: 0
3: 8
4: 159
Right 998101983 5:139442092-139442114 CTTTCAGAAACAGAAGAAGATGG 0: 1
1: 1
2: 9
3: 87
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998101977 Original CRISPR CAGTTTTAGTGGCTGGATTC AGG (reversed) Intronic
902333055 1:15740077-15740099 CAGTTCTGGAGGCTGGATGCTGG + Exonic
904458842 1:30663558-30663580 AAGATTTAGTGTCTGGATTGAGG + Intergenic
905263817 1:36737763-36737785 CTGTTTTCCTGGCTGGATCCTGG - Intergenic
906170962 1:43724808-43724830 CAGTTTTAGGGGCTGTATAAAGG + Intronic
906243942 1:44260119-44260141 CTGTTTGAGTTGCTGGGTTCTGG - Intronic
907723124 1:56992430-56992452 CAGTTCCCGGGGCTGGATTCCGG - Intergenic
908048603 1:60201874-60201896 CAGTTTTAGTGGATATAATCTGG - Intergenic
911635264 1:100228148-100228170 AAGTTTTAAAGGCTGAATTCAGG - Intronic
914829541 1:151160698-151160720 CAGTTTTATTGGCAAGATTAGGG - Exonic
915349170 1:155213800-155213822 CAGTGTGAGTGGCTTTATTCTGG - Exonic
915352357 1:155234427-155234449 CAGTGTGAGTGGCTTTATTCTGG - Intergenic
916064367 1:161124109-161124131 AAGTATTAGGGGCTGGAATCAGG - Intronic
918016686 1:180640842-180640864 CAGTTTTGGTGTTTGGCTTCTGG + Intronic
920450877 1:206060414-206060436 CAGTGTTAGTCTCTGGCTTCAGG - Intronic
920626241 1:207603716-207603738 CATTTTTAGTGGTTGCATTTTGG + Intronic
923331801 1:232932093-232932115 CAGCTTTAGTGGCTGTCTTTTGG - Intergenic
924094705 1:240539251-240539273 CAGTTATAATGGCTGGCTTGTGG + Intronic
1063355097 10:5391507-5391529 AAGCTTTAGTGGCTAGGTTCTGG - Intergenic
1065565200 10:27001237-27001259 CAGAGTTAGGGGCTGGAGTCTGG + Intronic
1066450012 10:35520420-35520442 CAGTTTTAATGTCTGGAGTAGGG - Intronic
1069331419 10:67297844-67297866 CAGTTTTTCTGGCTTGCTTCTGG - Intronic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1075424215 10:122328904-122328926 TAGTTTTAGCAGCTGGTTTCAGG - Intronic
1079898973 11:26157277-26157299 CAGTTTTATTTGCTTTATTCCGG - Intergenic
1080871319 11:36239619-36239641 CAGTTTTCGGGGCTGAATCCAGG + Intergenic
1081070946 11:38607429-38607451 CAGGTTTGGTGGATGGTTTCAGG + Intergenic
1082178895 11:49094949-49094971 CAGTTTAATTGGCTGAATTTAGG - Intergenic
1085780075 11:79400260-79400282 AAGTTGCAGTGACTGGATTCTGG - Intronic
1086686376 11:89737879-89737901 CAGTTTAATTGGCTGAATTTAGG + Intergenic
1087288364 11:96291878-96291900 CAATGTGAGTGGCTGGACTCTGG + Intronic
1087436881 11:98131336-98131358 CATTTCCAGTGGCTGCATTCGGG + Intergenic
1092032656 12:5301186-5301208 GAGTTTTATTGGCTGTAGTCAGG + Intergenic
1096810100 12:54163958-54163980 CAGTTATACTGCTTGGATTCAGG - Intergenic
1097211915 12:57377520-57377542 CAGGTTTAGCGGGTAGATTCTGG - Intronic
1098148350 12:67520610-67520632 AAATTTTAATGGCAGGATTCAGG - Intergenic
1099975441 12:89541429-89541451 AGCTTTTAGTGGCTGGAGTCAGG + Intergenic
1100620083 12:96262574-96262596 CTCTTTTTGTGGCTGGATCCAGG + Intronic
1102717316 12:114985658-114985680 CATATTTAGTGGCTGTATTAGGG - Intergenic
1104193094 12:126502332-126502354 CTCTTTTCATGGCTGGATTCAGG + Intergenic
1105049492 12:133036024-133036046 AAGGTTTAGAGGGTGGATTCTGG - Intergenic
1105984071 13:25548415-25548437 CTTTTTCAGTGGCTGAATTCTGG - Intronic
1105996261 13:25675005-25675027 CTGTTTTAATGGGTGCATTCTGG + Intronic
1107858588 13:44639327-44639349 CAGTGTTAGGTGCTAGATTCTGG + Intergenic
1107886024 13:44874701-44874723 CATTTTTGGTGGCTGGACTGTGG + Intergenic
1124904163 15:33852953-33852975 CAGTTTGAGTGCCTGGATCTGGG - Intronic
1125286126 15:38094321-38094343 CAGTTTTAGTGGATGGCTGAAGG - Intergenic
1125753443 15:42046075-42046097 CAGTAGGAGTGGATGGATTCTGG - Intronic
1127343955 15:58075168-58075190 GTGTTTTAGTTGCTGGTTTCTGG + Intronic
1130808207 15:87349534-87349556 CAGTTTTAGTGGGTGGGTATTGG - Intergenic
1135184030 16:20299242-20299264 TTGATTTATTGGCTGGATTCTGG + Intergenic
1141723929 16:85773697-85773719 CATTTTTAGCAGGTGGATTCAGG - Intronic
1142008838 16:87703620-87703642 CACCTTTAGAGGCTGGACTCAGG - Intronic
1142029649 16:87832178-87832200 CAGTTTTGGAGGCTGAGTTCTGG - Exonic
1144430316 17:15185279-15185301 AAGGTTTAATGGGTGGATTCTGG - Intergenic
1144716060 17:17436664-17436686 GAGTTTTGATGGCTGGAGTCTGG + Intergenic
1146769918 17:35559535-35559557 CAGTTTAGGTGGCTGTTTTCTGG - Intergenic
1147036382 17:37684698-37684720 CAGTGTTAGCTGCTGAATTCAGG - Intergenic
1149531723 17:57400992-57401014 CAGGTTTTGTGGATGGTTTCTGG + Intronic
1149921710 17:60666591-60666613 CAGTATTAGTGGTTGCATTAGGG + Intergenic
1150060312 17:62063181-62063203 CAGTTTTAGTCGCTGCCTTAAGG - Exonic
1151127066 17:71856557-71856579 GGGTTTTAGTAGCTGTATTCAGG - Intergenic
1153277189 18:3378825-3378847 CAGTTTCAGTGGCGGGATCTCGG - Intergenic
1156666866 18:39419463-39419485 CTGTTTTAGTAGTTGGACTCAGG + Intergenic
1159065270 18:63562436-63562458 CATTTTGAGTGGCTGGAGGCTGG + Intronic
1162171773 19:8795473-8795495 ATGTTTTAGGGGCTGGATTTAGG - Intergenic
1163252785 19:16136172-16136194 GAGTTTTAGTATCAGGATTCAGG - Intronic
1163699247 19:18778948-18778970 GTGTTTTAGTGGCAGGTTTCAGG + Exonic
1164904052 19:31952419-31952441 CAGTTTTATTGGTTGAAATCTGG - Intergenic
1164967557 19:32498637-32498659 AAGGTTTAGTGGCTGGGTTCTGG - Intergenic
926902415 2:17767970-17767992 TCTTTTTAGTAGCTGGATTCTGG + Intronic
929851885 2:45598915-45598937 CAGTTTTTTTGGCTGGCTTTGGG - Intronic
929980778 2:46678014-46678036 CATGTTTAGTGCCTGGATTTTGG + Intergenic
930381687 2:50637738-50637760 CAGTCTTTGTGGCTGGAATAGGG + Intronic
931881901 2:66577295-66577317 CATTTTTAGGGCCTTGATTCTGG + Intergenic
933669745 2:84995377-84995399 CAGTTCTAGAGTCTTGATTCAGG + Intronic
935414343 2:102799802-102799824 CAGGTTTCGTGGCTGGCTTTGGG + Intronic
937393977 2:121518418-121518440 CAGTTTTAGAGGCCGGGTTCTGG - Intronic
937558804 2:123194526-123194548 CAGTGTTGGTGGGTGGAGTCTGG + Intergenic
938171606 2:129082204-129082226 AAGTTTTAGTGGGCAGATTCTGG - Intergenic
940007441 2:149020756-149020778 CAGTTTCAGTGGTGGCATTCAGG + Intronic
941610571 2:167656807-167656829 TAGATTTAGTGTCTGGATTTGGG + Intergenic
941730691 2:168913804-168913826 GAGTTTTAGTGGTTAGATGCAGG - Intergenic
948617671 2:239211765-239211787 CAGTTTAAGATGCTGGATTCTGG - Intronic
1169892190 20:10465329-10465351 AAGTGGGAGTGGCTGGATTCCGG - Intronic
1169917556 20:10698703-10698725 CATTTAGAGTGGCTGGATGCTGG + Intergenic
1172828463 20:37811016-37811038 TAGTATTAGTGGCTGGAATGAGG + Intronic
1174121324 20:48267952-48267974 CGGGTTTAGGGGGTGGATTCTGG + Intergenic
1174961653 20:55164437-55164459 TAGTTCTTGTAGCTGGATTCAGG + Intergenic
1175256032 20:57647753-57647775 CATTGCTAGTGGCTGGCTTCTGG + Intergenic
1175313036 20:58024991-58025013 CACATTAGGTGGCTGGATTCTGG + Intergenic
1176123486 20:63464707-63464729 CACACTGAGTGGCTGGATTCTGG - Intronic
1177155361 21:17495751-17495773 GAGTTTTAGTAGCTGGACTCTGG + Intergenic
1178935796 21:36860399-36860421 CACTTTTAGTGGCTAGTTTGGGG - Intronic
1182029932 22:27150695-27150717 CCTTTTTGGTGGCTGGATTATGG - Intergenic
1182345939 22:29664840-29664862 GAGGTTTAGTGCCTGGATACTGG + Intronic
949340392 3:3023597-3023619 CAGTTTTAGGGACTGGAGCCTGG + Intronic
949617809 3:5774388-5774410 ATGTTTTAGGGGCTGGATTTAGG - Intergenic
953380905 3:42472407-42472429 CAGTTTTGGAGGCTGAGTTCGGG - Intergenic
953429638 3:42828498-42828520 CACTTTTAGGGGCTGCATTGTGG - Intronic
954856435 3:53647751-53647773 CCTTTTTAGTGGCAGGATTGAGG + Intronic
954864205 3:53715153-53715175 CAGATTTAGGGGCTGGATCAAGG + Intronic
955070015 3:55564771-55564793 CAGCCTTAGTGGCTGTATTTTGG - Intronic
958580467 3:96013088-96013110 GAAGTTGAGTGGCTGGATTCTGG - Intergenic
959569089 3:107862973-107862995 CAGTTTTAGTGAGTTGATTGTGG + Intergenic
961372698 3:126441100-126441122 CAGTTTGAGGGGCTGGAATGGGG - Intronic
963298412 3:143572992-143573014 CAATTTTAGAGCCTGGGTTCTGG - Intronic
965885590 3:173442433-173442455 CATTATTTTTGGCTGGATTCAGG - Intronic
967264380 3:187677439-187677461 CAGTTTTAATGCCTGGTTTTAGG - Intergenic
968197146 3:196716162-196716184 CAGCTTGAGTGTCTGGAATCTGG + Intronic
975088554 4:70373077-70373099 AAGGTTTAGTGGGTGGATTTTGG - Intronic
977733999 4:100390251-100390273 ACCTTTTAGGGGCTGGATTCTGG + Intergenic
979842537 4:125462206-125462228 CTGTTTTTGTGGCTTGATTACGG - Intronic
983210999 4:164957313-164957335 GAATTTTAGTGGCAGCATTCCGG + Exonic
983954632 4:173682824-173682846 CAGTTATAGTGTCTGGAACCTGG + Intergenic
985327880 4:188793512-188793534 CACTTTTAGTCTCTGGGTTCTGG + Intergenic
985560944 5:585402-585424 CAGGTTGAATGGATGGATTCAGG + Intergenic
991770050 5:70031799-70031821 CAGTTTTAGTGACTAGCTTTTGG + Intronic
991849345 5:70907218-70907240 CAGTTTTAGTGACTAGCTTTTGG + Intronic
992485767 5:77192869-77192891 CCATTTTAGTGGCTGTATGCTGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
992881978 5:81119292-81119314 CAGTTCTAGAGGCTGGCATCTGG + Intronic
994004134 5:94817890-94817912 CACTTTTAGTTGATGGTTTCTGG + Intronic
994635658 5:102342153-102342175 CAATTTGAGTGCCTGGATTTGGG - Intergenic
995556703 5:113337197-113337219 AAGTTTTAGTGGCAGTATTTGGG + Intronic
998101977 5:139442057-139442079 CAGTTTTAGTGGCTGGATTCAGG - Intronic
1002302100 5:178263069-178263091 CAGGTTCAGTGTCTGGATTAGGG + Intronic
1008106869 6:47448621-47448643 CAGTTGTAGAGGCTGAGTTCAGG - Intergenic
1010896153 6:81366887-81366909 CAGTTTTAAAGGCTGCATTCAGG + Intergenic
1010942725 6:81937818-81937840 AAGTGTTAGTGGATGGATTTAGG + Intergenic
1012180564 6:96147334-96147356 CATTTTTAGTGGATGGAGTAGGG + Intronic
1019447720 7:1080007-1080029 CTGTTTTGGTGGCCGGTTTCCGG - Intronic
1020001500 7:4758873-4758895 GAGTTTTAAAGGCTGGGTTCAGG + Intronic
1020332679 7:7036020-7036042 CAGTCCTAGTGTCTGGAGTCTGG + Intergenic
1020993146 7:15227785-15227807 AAGGTTTAGAGGGTGGATTCTGG - Intronic
1021505938 7:21385162-21385184 GGGTTTTAGTGCCTGGATCCAGG + Intergenic
1029323740 7:99787919-99787941 AAGTTTTAGTGGCTGGAGGAGGG + Intergenic
1030071724 7:105703708-105703730 CAGATTTGGTGGCTGGACACAGG - Intronic
1030943121 7:115680509-115680531 CAGTTAGAGTAGCTGGATACTGG + Intergenic
1038596614 8:28891301-28891323 CAGTTCTCGTGGCTGGAGTTTGG - Intronic
1039091229 8:33831752-33831774 AAGGTTTAGGGGCTGGATTCTGG + Intergenic
1039335752 8:36587388-36587410 CAATTTTAGTGGCAGTGTTCAGG + Intergenic
1039642758 8:39241642-39241664 CAGCTTGAGTGGCTGGATGCAGG + Intronic
1042095234 8:65208377-65208399 CAGGCTTAGTGACTGGATTCTGG + Intergenic
1045007566 8:97929494-97929516 CAGCTTTAGTGGGTGGAGGCTGG - Intronic
1045339157 8:101236356-101236378 AAGTTTTGGTGACTGGTTTCTGG + Intergenic
1045564556 8:103299503-103299525 CAGTTTTTGTGGCAGTCTTCTGG - Intronic
1047489944 8:125366104-125366126 CAGCTTCACTGGCTGGACTCAGG - Intronic
1049629362 8:143644348-143644370 CAGTTTTATTTACTGGCTTCTGG + Intronic
1050467817 9:5949553-5949575 AAGTCTTAGCAGCTGGATTCTGG + Intronic
1051206648 9:14695166-14695188 CAATTCTGGTAGCTGGATTCGGG - Intergenic
1052042109 9:23750613-23750635 CAATTTTAGAGGCAGGATTTGGG + Intronic
1052374916 9:27707932-27707954 AAGGTTTAGGGGGTGGATTCTGG - Intergenic
1056699647 9:88891741-88891763 CAGTTTTAAAGCCTGGACTCAGG + Intergenic
1056781616 9:89555069-89555091 CTGTTTTAGAGACTGGATTTGGG - Intergenic
1058151072 9:101464142-101464164 AAGGTTTAGGGGATGGATTCTGG + Intergenic
1059421399 9:114194677-114194699 CAGTTTTGTTGGTTGCATTCTGG - Intronic
1059882341 9:118705484-118705506 CAGTTGTGATGGCTGCATTCTGG + Intergenic
1062246342 9:135568891-135568913 CAGTATTAGTGGCTGTAAACAGG + Intergenic
1062647462 9:137556145-137556167 CTGTTTCAGAGTCTGGATTCTGG + Intronic
1186621697 X:11247975-11247997 CATTTTTAGTGGTTGAAATCAGG - Intronic
1188019719 X:25144032-25144054 CAGTTTGAGTGGCTGGACCTGGG + Intergenic
1188273071 X:28166479-28166501 CAGTTTAAGTACCTAGATTCTGG + Intergenic
1190577369 X:51854015-51854037 CAGTTTTTGTTCCTGGGTTCTGG + Intronic
1191665653 X:63699934-63699956 CTGTTATAGTTGATGGATTCTGG + Intronic
1192789759 X:74369821-74369843 CAGATTAAGTAGCTGGCTTCTGG + Intergenic
1196356803 X:114804520-114804542 CAGCTTTAGTATATGGATTCTGG + Intronic
1196676030 X:118420804-118420826 CAATTTTATCTGCTGGATTCAGG - Intronic
1199066631 X:143426484-143426506 AAGGTTTAGGGGGTGGATTCTGG - Intergenic