ID: 998104013

View in Genome Browser
Species Human (GRCh38)
Location 5:139456950-139456972
Sequence TGGGCTCTCCCCGACCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998104013_998104026 23 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104026 5:139456996-139457018 CACGGGTTTACTGGCTGCCATGG No data
998104013_998104021 6 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104021 5:139456979-139457001 GTGCCTGCCCTCGGCATCACGGG 0: 1
1: 0
2: 0
3: 7
4: 112
998104013_998104020 5 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104020 5:139456978-139457000 GGTGCCTGCCCTCGGCATCACGG 0: 1
1: 0
2: 1
3: 5
4: 127
998104013_998104028 25 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104028 5:139456998-139457020 CGGGTTTACTGGCTGCCATGGGG 0: 1
1: 0
2: 0
3: 7
4: 65
998104013_998104018 -3 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104018 5:139456970-139456992 CCATCCACGGTGCCTGCCCTCGG 0: 1
1: 0
2: 1
3: 12
4: 209
998104013_998104025 14 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104025 5:139456987-139457009 CCTCGGCATCACGGGTTTACTGG No data
998104013_998104027 24 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104027 5:139456997-139457019 ACGGGTTTACTGGCTGCCATGGG 0: 1
1: 0
2: 0
3: 2
4: 60
998104013_998104029 26 Left 998104013 5:139456950-139456972 CCAACCAGGTCGGGGAGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998104029 5:139456999-139457021 GGGTTTACTGGCTGCCATGGGGG 0: 1
1: 0
2: 1
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998104013 Original CRISPR TGGGCTCTCCCCGACCTGGT TGG (reversed) Intronic
900367593 1:2317603-2317625 TGGGCTCCTCCGGACCTGGTGGG - Intergenic
903828457 1:26161204-26161226 TGGGCTCTCACTGACCTGCAGGG - Exonic
903951625 1:26999042-26999064 TGGGCACACCCCAACCTGGCTGG + Intronic
905650966 1:39656749-39656771 TGGGCTGTGCCCGGCCTTGTAGG + Intergenic
909075532 1:71047273-71047295 CTGGCGCTCACCGACCTGGTCGG - Exonic
912418879 1:109530229-109530251 TGGGCTGGCCCTGACCTGGCTGG - Intergenic
912798656 1:112707298-112707320 GTGGCTCTCCCCGACCTGGAGGG - Intronic
917594203 1:176511879-176511901 TGGGTTCTCTCCTACTTGGTAGG + Intronic
921148149 1:212378546-212378568 TGGGCTCAGCAGGACCTGGTAGG + Intronic
922722023 1:227904195-227904217 TGGGCCCTCCCTGACCAGGCAGG + Intergenic
1064017401 10:11783319-11783341 GGGGCTGTCCCAGGCCTGGTAGG + Intergenic
1067242658 10:44509293-44509315 TGGGCTCTGGGTGACCTGGTGGG + Intergenic
1070487271 10:76942983-76943005 TGGGCCATCCCAGACCTGCTGGG - Intronic
1075960586 10:126564292-126564314 TGTGCTCACCACAACCTGGTGGG - Intronic
1076693281 10:132234624-132234646 AGGGCTCTCCCCCTCCTGCTTGG + Intronic
1077002401 11:330833-330855 TGGGGGCTCCCCAACCTGGGCGG + Intergenic
1077180500 11:1210486-1210508 TAGGATCTCCCCGACCAAGTTGG + Intergenic
1084580467 11:70020021-70020043 TGGCCTCTCCCCAACCTTGGAGG - Intergenic
1090078516 11:123594631-123594653 TGGGCTCCCCCAGTGCTGGTGGG + Intronic
1094099017 12:26741226-26741248 TGGGCCCTCCCAGGCCTGGAAGG - Intronic
1096464925 12:51843034-51843056 TGGGCTCTCCCTGGCCATGTGGG + Intergenic
1099216127 12:79855653-79855675 AGTGCTATCCCAGACCTGGTGGG - Intronic
1102668007 12:114592568-114592590 TAGGGTCTCCCCGACCGAGTTGG + Intergenic
1104655860 12:130573630-130573652 TGGGCTGACCCCCACCTGGGGGG + Intronic
1104946606 12:132417465-132417487 TGGGCACTCCCTGGCTTGGTGGG + Intergenic
1121045197 14:90782627-90782649 TGGCCTGTCCCCTACCTGGGTGG - Intronic
1121332403 14:93057942-93057964 AGGGCTCTCGCCGAGCTGATGGG - Intronic
1125756406 15:42068601-42068623 TGGGCTCTCCCAGGCCTGGGTGG - Exonic
1130221412 15:82022610-82022632 TGGGCTTTCCTGGGCCTGGTGGG + Intergenic
1132893716 16:2217492-2217514 TGAGCTCTGCCCCATCTGGTCGG + Intergenic
1135070725 16:19349195-19349217 TGGGCTCTCCCAGACCAGGCAGG - Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1137608948 16:49806164-49806186 TGGGCTCTCGCCCACCAGCTGGG + Intronic
1139023384 16:62781521-62781543 GAGGCTCTCCCAGACCTGTTTGG + Intergenic
1142181342 16:88672361-88672383 TGGGCTCTGCCCAGCATGGTGGG - Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1143779562 17:9222140-9222162 GGGCCTCTCCTTGACCTGGTGGG + Intronic
1143852650 17:9824235-9824257 TGTGCTCTCACTGGCCTGGTGGG + Intronic
1144768291 17:17745001-17745023 GGGGCTCTCACAGTCCTGGTGGG + Intronic
1145263886 17:21370239-21370261 TGGGCTCGGACCCACCTGGTGGG - Intergenic
1145307013 17:21680972-21680994 TGGGCTTTCCTCCTCCTGGTCGG + Intergenic
1145307465 17:21683302-21683324 TGGGCTTTCCTCGTCCTGGTCGG + Intergenic
1148883265 17:50749337-50749359 TGGGCTCTAACTGACCTTGTGGG - Intronic
1152567253 17:81105856-81105878 CGGGCTGTCCTCAACCTGGTGGG - Intronic
1160659722 19:292261-292283 AGGGCTCCCCACGACCTGGTGGG - Intergenic
1160800101 19:963726-963748 TGGGCTAGCCCCGACATGGGGGG - Intronic
1160904171 19:1444839-1444861 TGGACTCTCCCAGACCTGCCCGG + Intergenic
1162895580 19:13763154-13763176 TGAGCTCTCCCAGGGCTGGTGGG - Exonic
1165399035 19:35586012-35586034 TGGGCTCCGCCCACCCTGGTAGG - Intergenic
1165899650 19:39163144-39163166 GGGGCCCTCCCAGAGCTGGTAGG + Intronic
1167525895 19:49983544-49983566 TGGGCTCTCCCTGGCCAGGTGGG + Intronic
928234852 2:29530516-29530538 TGGTCTCTGCCAGTCCTGGTAGG + Intronic
929630872 2:43460782-43460804 TGGGCTCTCCCCCACCAGTTTGG - Intronic
933011449 2:77069212-77069234 TAGGGTCTCCCCGACCGAGTTGG + Intronic
940060955 2:149567096-149567118 TGGGCTCTCCTAGACATTGTAGG - Intergenic
940301237 2:152178139-152178161 TAGGCTCTCCCCGACCGAGCTGG + Intergenic
944924955 2:204455104-204455126 TGGGCTCTGCACACCCTGGTGGG - Intergenic
948758039 2:240170361-240170383 TGGCCTCTCCCCTAGCTGATAGG - Intergenic
1171807161 20:29689989-29690011 TGGGGTTTCCTCAACCTGGTCGG - Intergenic
1172621662 20:36321510-36321532 TGTGCTCTGCCCAGCCTGGTGGG + Intronic
1172650350 20:36497892-36497914 TGGACTCTCCCTGCCCTGGCTGG + Intronic
1174169455 20:48606997-48607019 TGGGCTCCCCCAGCCCAGGTGGG - Intergenic
1175205751 20:57309883-57309905 TGGGCTCTCTAGGAGCTGGTGGG + Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1177683799 21:24410582-24410604 TAGGGTCTCCCCGACCTAGCTGG - Intergenic
1179810027 21:43864784-43864806 AGGGCTCCCCCGGACCGGGTCGG - Intergenic
1180048229 21:45319521-45319543 TGGGCACTGCCTGACCAGGTGGG + Intergenic
1182476650 22:30580178-30580200 TGGGCTCTCCCTGTCCCTGTAGG - Exonic
951801126 3:26597035-26597057 TGAGCTCACCCCATCCTGGTTGG + Intergenic
953611483 3:44450875-44450897 TGGGCTGTCAGGGACCTGGTTGG + Exonic
954686215 3:52371684-52371706 AGGGCTCTCCCTGCCCAGGTTGG - Intronic
957199301 3:77112095-77112117 TGGGCTCTTCCCGACTAGCTGGG - Intronic
969306326 4:6328082-6328104 TGGGCTCTCCCAGACCTCTGAGG - Intronic
970583622 4:17494964-17494986 TGGGCTCCCTCCGCCCTGATCGG - Intronic
974764125 4:66319056-66319078 TTGGCTCACCCAGAGCTGGTAGG - Intergenic
979231429 4:118352662-118352684 GGGGCGCTCCCCGAAGTGGTCGG - Exonic
987482811 5:18480122-18480144 TAGGGTCTCCCCGACCTAGCTGG - Intergenic
998104013 5:139456950-139456972 TGGGCTCTCCCCGACCTGGTTGG - Intronic
1002441609 5:179267217-179267239 GGGGCTCTTCCTGGCCTGGTGGG + Intronic
1006518340 6:34556809-34556831 TGGGCCAACCACGACCTGGTGGG + Intergenic
1006903148 6:37515937-37515959 CAGGCTCTCCCCCACCGGGTGGG - Intergenic
1017947541 6:159107948-159107970 TGGGCTCTCCGCTGCCTCGTGGG - Intergenic
1017967492 6:159279129-159279151 TGGGCACTCCCAGACCAGCTTGG - Intergenic
1018610702 6:165645162-165645184 TGGGCTCTCCTGGCCCTGGCAGG - Intronic
1018847694 6:167566803-167566825 TCGGCTCTCCCCGAGCGGATGGG - Intergenic
1019415912 7:926434-926456 TGGCTTCTCCCCGACCCTGTGGG + Intronic
1019575222 7:1734531-1734553 TGAGCCCTCCCCGCTCTGGTCGG + Intronic
1024341750 7:48271353-48271375 TGGGCACTCCCAGTCCTGGAAGG - Intronic
1026903056 7:74047607-74047629 TGGGCTCCCACCAACCTGGGTGG - Intronic
1034413512 7:150953429-150953451 TGGGCTGTCCCGGACCTGTGTGG - Intronic
1035381550 7:158444236-158444258 TGGCCTCTCCAGGACCTGTTAGG - Intronic
1039570978 8:38586125-38586147 GGGGCTCTCCCCTAAATGGTAGG - Intergenic
1039846226 8:41327361-41327383 TGGGCTGTCACCGACCTTGCAGG + Intergenic
1039912469 8:41835941-41835963 TGCCCTCTCCCCTCCCTGGTGGG - Intronic
1047562841 8:126008204-126008226 TAGGGTCTCCCCGACCTAGCTGG + Intergenic
1049324621 8:142015570-142015592 TGGGGGCTCCCCGGCCTGGGAGG - Intergenic
1049386788 8:142346937-142346959 TGGGCCCTCGCCCACCTCGTGGG - Intronic
1049537565 8:143189457-143189479 TGGGCTCTCCCCACCCCTGTGGG + Intergenic
1050124925 9:2347036-2347058 TGGTTTCTCCCCGGCCTGCTTGG + Intergenic
1061179042 9:129013306-129013328 TGGCCTCTCCCTCACCTGGTGGG - Intronic
1061603111 9:131685781-131685803 TAGGGTCTCCCCGACCTAGCTGG + Intronic
1062265490 9:135684899-135684921 CTGCCTCGCCCCGACCTGGTTGG - Intergenic
1062309463 9:135928324-135928346 CAGGCTCTCCCCGACCTGCCAGG + Intergenic
1186498811 X:10034136-10034158 TTGGCTCCCCACCACCTGGTTGG - Intronic
1196745748 X:119070488-119070510 TGGGCTCTACCTGGCCTGGAAGG + Intergenic
1197939661 X:131776675-131776697 AGGGCTCTCCCTGACCCAGTAGG + Intergenic
1200148777 X:153941463-153941485 TGGGCGCTCTCCCACCTGGGTGG + Exonic