ID: 998104964

View in Genome Browser
Species Human (GRCh38)
Location 5:139462627-139462649
Sequence CAGCTGTGCTGGGTGATCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 333}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998104964_998104969 -9 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104969 5:139462641-139462663 GCACAGCTGCATGGCTCCTGCGG 0: 1
1: 0
2: 2
3: 32
4: 234
998104964_998104971 7 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104971 5:139462657-139462679 CCTGCGGTGCCCATGTCAGCTGG 0: 1
1: 0
2: 2
3: 19
4: 160
998104964_998104972 8 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104972 5:139462658-139462680 CTGCGGTGCCCATGTCAGCTGGG 0: 1
1: 0
2: 2
3: 13
4: 107
998104964_998104978 23 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104978 5:139462673-139462695 CAGCTGGGTATGTGGCGGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 206
998104964_998104973 15 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104973 5:139462665-139462687 GCCCATGTCAGCTGGGTATGTGG 0: 1
1: 0
2: 1
3: 8
4: 137
998104964_998104977 19 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104977 5:139462669-139462691 ATGTCAGCTGGGTATGTGGCGGG 0: 1
1: 0
2: 3
3: 24
4: 291
998104964_998104976 18 Left 998104964 5:139462627-139462649 CCCAGGATCACCCAGCACAGCTG 0: 1
1: 0
2: 4
3: 45
4: 333
Right 998104976 5:139462668-139462690 CATGTCAGCTGGGTATGTGGCGG 0: 1
1: 0
2: 0
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998104964 Original CRISPR CAGCTGTGCTGGGTGATCCT GGG (reversed) Exonic
900023714 1:202611-202633 CAGCTGGGCTGAGTGGGCCTGGG + Intergenic
900236177 1:1592214-1592236 CAGCTTCTCTTGGTGATCCTTGG - Intergenic
900405746 1:2492245-2492267 CAGCTGTGCCGAGTGCTCCGAGG - Intronic
900519980 1:3100776-3100798 CAGCTGTGCTGAGTCAGCCCAGG - Intronic
900617457 1:3571787-3571809 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617485 1:3571882-3571904 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617556 1:3572153-3572175 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617579 1:3572250-3572272 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617606 1:3572346-3572368 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617615 1:3572384-3572406 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617624 1:3572422-3572444 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617807 1:3573158-3573180 CAGGTGTGCTGGGTCCTCCCTGG + Intronic
900845999 1:5101367-5101389 CATCTGCCCTGGGTGATTCTGGG - Intergenic
900978673 1:6034072-6034094 CAGCTAAGCTGGGTGGCCCTGGG - Intronic
901043212 1:6378533-6378555 CAGCTGAGCTGTGTGAGGCTGGG - Intronic
901908414 1:12434342-12434364 CAGCTGTGAAGGGTGCTGCTGGG + Intronic
902447561 1:16476685-16476707 CTGCTGTTCTGGATGCTCCTGGG - Intergenic
902467459 1:16626900-16626922 CTGCTGTTCTGGATGCTCCTGGG - Intergenic
903016513 1:20365548-20365570 CAGCTGTGCAGGGACCTCCTGGG - Intergenic
903049355 1:20589298-20589320 CTGCTGGGCTGGGGGACCCTGGG - Intronic
903179931 1:21600070-21600092 CACCTGTGCTGAGTGACCCTGGG - Intronic
903242001 1:21989159-21989181 CAGCCCTGCTGTGTGACCCTGGG - Intronic
903245509 1:22012347-22012369 CAGCCCTGCTGTGTGACCCTGGG - Intronic
903539563 1:24089473-24089495 CAGATGTGCTGTGGGACCCTGGG - Intronic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
904675235 1:32195126-32195148 CTTCTGTGCTCGGTGCTCCTGGG - Exonic
904838811 1:33357074-33357096 CAGCTGAGCTGCTTCATCCTAGG - Intronic
905077745 1:35288551-35288573 CAGCTGTGCTGGGTGGAATTAGG - Intronic
905257478 1:36694337-36694359 CAGCTAGGCTGAGGGATCCTGGG - Intergenic
905813016 1:40926799-40926821 CTGCTTTGCTCTGTGATCCTAGG + Intergenic
906142453 1:43541942-43541964 CAGCATGGCTGGGTGAGCCTGGG - Intronic
906606328 1:47174907-47174929 CAGCTGGGCTGGGTGAGCCCAGG - Intergenic
913358268 1:117948199-117948221 CTGATGTGCTGGGTTAACCTTGG - Intronic
915228974 1:154431740-154431762 CAGCTGTTTTGGGTGACTCTGGG + Intronic
915300314 1:154947846-154947868 CAGCTGTTCAGGGTGCCCCTTGG - Intronic
915663667 1:157424877-157424899 GCGCTGTGCTGGGAGATCCGTGG - Intergenic
916619419 1:166480049-166480071 CAGCAGTGCCTGGTGCTCCTGGG - Intergenic
917353518 1:174102805-174102827 CATCTGTGCTCAGTGATCTTTGG + Intergenic
919976467 1:202616052-202616074 CAGAGGGCCTGGGTGATCCTGGG - Intronic
920011813 1:202873585-202873607 CAGCAGCACTGGGTGCTCCTTGG - Intergenic
921249401 1:213282110-213282132 CAGTTGTGCTGGCTGCTCCTCGG + Intergenic
921250653 1:213294647-213294669 GAACTGTTCTGGCTGATCCTAGG - Intergenic
922196261 1:223363245-223363267 CAGCTGTGGTGGGAGGGCCTGGG - Intronic
923137778 1:231133613-231133635 CAGCTTTGCTTGGTGTTCCCAGG + Intergenic
923667067 1:236007794-236007816 CAGCTTTCCTGGGTGGTCCCTGG - Intronic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1064697346 10:17981442-17981464 CAGCTTTGCTTGTTGGTCCTTGG - Exonic
1066078914 10:31910003-31910025 CAGCAGTCCTTGGTGTTCCTTGG - Intronic
1066323673 10:34331327-34331349 CATCTCTGCTGGGAGAACCTGGG + Exonic
1070151910 10:73810803-73810825 CAACTGAGCTGTGTGATCCTGGG - Exonic
1070831584 10:79421196-79421218 CAGCTGGGATGGGTGTTGCTGGG - Intronic
1071554128 10:86589348-86589370 CAGTTTTGCTGGGGCATCCTAGG + Intergenic
1072513799 10:96155959-96155981 CAGCTCTGCTGTGTGACCTTGGG - Exonic
1072707275 10:97689690-97689712 TATCAGTGCTGGGTGAACCTAGG + Intergenic
1073190828 10:101649730-101649752 CCCCTGTGCTTGGTGAACCTTGG + Intronic
1073566419 10:104539426-104539448 GAGCTTTGCTGTGTGACCCTGGG - Intergenic
1073692096 10:105820388-105820410 CTGCCTTGCTGTGTGATCCTAGG - Intergenic
1074496236 10:113982507-113982529 CAGCTGTGCTGTATGACCTTGGG + Intergenic
1075566534 10:123509007-123509029 CAGCAGTGCTGTGTGACCTTGGG - Intergenic
1075995479 10:126873274-126873296 GAGGTGTGCAGGGTGATCCTGGG + Intergenic
1076380827 10:130023589-130023611 CAGGTGTGCTGGCTGGGCCTGGG - Intergenic
1076875663 10:133214427-133214449 CCTCAGTGGTGGGTGATCCTTGG + Intronic
1081661807 11:44893006-44893028 TAGCTGTGCTGTGTGACTCTGGG + Intronic
1082891314 11:58141830-58141852 CCTTTGTGCTGGGTGATCTTAGG + Intronic
1083023835 11:59533223-59533245 CCACTGTGCTGGGCGATCTTTGG - Intergenic
1083550172 11:63582351-63582373 CCTCTGTGCTGGTTGCTCCTTGG - Intronic
1083926329 11:65809204-65809226 CAGCTGCGCTGGCTGAACCCAGG - Intergenic
1084497760 11:69514951-69514973 CTGCTGGGCTGTGTGTTCCTAGG - Intergenic
1085026204 11:73238043-73238065 CAGCTGGGCTGGATAATCCCTGG - Intergenic
1085120418 11:73964143-73964165 CTGATGTGCTGTGTGATCCGTGG - Intronic
1085695542 11:78701649-78701671 CAGGTGTACTGGGTGACCATGGG - Exonic
1086064033 11:82728401-82728423 CATCTCAGCTGGGTGTTCCTTGG - Intergenic
1088902482 11:114128631-114128653 TAGCTGTGCTTGTTGTTCCTGGG + Intronic
1088911068 11:114192960-114192982 CAGCTGTGGAGGCTGTTCCTAGG + Intronic
1089179126 11:116568887-116568909 CTGATGTGCTGCATGATCCTAGG + Intergenic
1089715368 11:120353941-120353963 ACCCTGTGCTGGGTGATGCTGGG + Intronic
1089902677 11:122004308-122004330 CAGCTGTGGTTGGAGATCATAGG + Intergenic
1090226049 11:125072950-125072972 CAGCTGTGTTGTGTGACACTAGG - Intronic
1091357838 11:134951506-134951528 CTGCTGAGCTGGGTGCTCATGGG + Intergenic
1091377411 12:34143-34165 CAGCTGGGCTGAGTGGGCCTGGG + Intergenic
1091589373 12:1834384-1834406 CAGCTGGGCTGGATATTCCTGGG + Exonic
1091823343 12:3492088-3492110 GAGCTGGGGTGGGTAATCCTGGG + Intronic
1092109568 12:5949323-5949345 TAGCTGTCCTGGGTGCTTCTGGG - Intronic
1092731648 12:11540380-11540402 CAGCTGGGCTGAGTGGGCCTGGG - Intergenic
1092842361 12:12555106-12555128 CAGCTGAGCTGTGTGCTCTTTGG - Intronic
1094500676 12:31018280-31018302 CAGCTGGGCTGAGTGGGCCTAGG + Intergenic
1096079909 12:48826442-48826464 CAGCTGTGCTGGGTGGTTGATGG - Exonic
1096235203 12:49921715-49921737 CAGCTGGCCTGGGGGGTCCTTGG + Intergenic
1100089759 12:90954968-90954990 CAGGTGTGCTGGGTGGGACTGGG + Exonic
1101714256 12:107296739-107296761 CAGCTGTTCTGGGTGTGGCTGGG + Intergenic
1101838089 12:108309019-108309041 CAGCTCTGCTGTGTGACCATGGG + Intronic
1102050888 12:109861179-109861201 CAGGTGTGCAGGGTCACCCTGGG - Intronic
1102192475 12:110999112-110999134 CAGCTGGTCTGGGAGATCCCAGG - Intergenic
1102348578 12:112175392-112175414 CAGCAGTGCTGGTTTCTCCTGGG - Intronic
1102502135 12:113359876-113359898 AGGCTGTGCTGGGGGATCCTAGG + Intronic
1104395091 12:128425704-128425726 CAGCTGTCCTCGATGGTCCTTGG + Intronic
1104731498 12:131107881-131107903 CAGCAGAGCTGGGTTGTCCTGGG + Intronic
1104972311 12:132537424-132537446 CAGCTGTGGTGGGTCCTCCCTGG + Intronic
1105424822 13:20285146-20285168 CAGGAGCGCTGGGTGATTCTGGG + Intergenic
1106369483 13:29117637-29117659 CGGCTATGGTGGGAGATCCTTGG - Intronic
1107531390 13:41285433-41285455 AAGCCATGCTGGGTGATCCAGGG - Intergenic
1113522261 13:110949386-110949408 AAGCTGTGATGGGTGCTCCTAGG + Intergenic
1113902731 13:113805659-113805681 CCGCTGTGCTGGGGCACCCTAGG + Intronic
1114349032 14:21829581-21829603 CAGCTGTGCTGTGAGTTGCTGGG + Intergenic
1117267387 14:54104016-54104038 CAGCTGTCCAGGGTGATCCTGGG - Intergenic
1117317781 14:54590650-54590672 CAGCTGTGCTGAGTCCTTCTAGG + Intronic
1117471470 14:56050579-56050601 CAGCTGTGATGAGGGAGCCTCGG + Intergenic
1119634783 14:76264997-76265019 CATCTGTGCTGGGACATCCTAGG + Intergenic
1121246465 14:92464577-92464599 CAGCAGGGCTGGGGGATGCTGGG - Intronic
1121473328 14:94173856-94173878 CAGCTGGGGTGGGCGGTCCTGGG + Intronic
1121909959 14:97780788-97780810 CAGCAGTGCTGAGTGCTCCTAGG + Intergenic
1122152433 14:99732188-99732210 CAGCTGCACCGGGTGTTCCTGGG - Intergenic
1122686070 14:103507298-103507320 CTGCTGTGATGGGTGTTTCTGGG - Intergenic
1122842653 14:104473881-104473903 CACCTGTGCTGCGTGTTCCCAGG + Intergenic
1122848177 14:104512240-104512262 CTGCTGGGCTGGGTTGTCCTGGG - Intronic
1123084203 14:105709996-105710018 GAGCTGAGCTGGGTGAGCTTAGG - Intergenic
1124625869 15:31307234-31307256 CGGCTCTGCTGTGTGATACTGGG - Intergenic
1127536776 15:59897239-59897261 CCTCTGTGCTGGGTGGTACTGGG + Intergenic
1127681892 15:61305642-61305664 CAGCTATCCTTGGTGTTCCTTGG - Intergenic
1128338574 15:66804074-66804096 CAGAAGTGATGGATGATCCTAGG + Intergenic
1128516055 15:68342579-68342601 CAGCTGAGCTGCGTGCTCCCAGG + Intronic
1129205619 15:74035584-74035606 CAGCTGGGCAGGATGTTCCTGGG - Intronic
1129264153 15:74385030-74385052 CAGCTATGCTGTGTGACCTTGGG - Intergenic
1129978678 15:79846358-79846380 CAGCTGTCCTGGGGGTTTCTGGG + Intronic
1131145241 15:90006889-90006911 CAGCTTTGCTGGGAGCTCATTGG + Intronic
1131298225 15:91171208-91171230 TAGCTCTGCTGTGTGATCTTAGG + Intronic
1132647392 16:1005238-1005260 CAGCTGGGCTAGGTGAACCTGGG - Intergenic
1133788133 16:8988817-8988839 CAGCTCTGCTGTGTGATATTAGG - Intergenic
1134518011 16:14902707-14902729 CCCCTGTGCTGGGTGCTGCTTGG + Intronic
1134630783 16:15754421-15754443 CAGCTTTGCTGGGTTATCATGGG + Intronic
1134705682 16:16301362-16301384 CCCCTGTGCTGGGTGCTGCTTGG + Intergenic
1134961859 16:18410752-18410774 CCCCTGTGCTGGGTGCTGCTTGG - Intergenic
1134966157 16:18493351-18493373 CCCCTGTGCTGGGTGCTGCTTGG - Intronic
1135672659 16:24388513-24388535 CAGCTGTGAGGGGTGATCCACGG - Intergenic
1135976605 16:27112586-27112608 CAGATGTGCTGTGTGACCTTGGG + Intergenic
1136182701 16:28565330-28565352 CAGGTGTGATGGTTAATCCTAGG - Intronic
1137693486 16:50446002-50446024 CATCTTTGCTGGGTGACCATGGG + Intergenic
1141151356 16:81566500-81566522 CAGCTTTGCTGTGTGACTCTGGG + Intronic
1141186317 16:81790009-81790031 GAGCTTTGCTGTGTGATCTTGGG + Intronic
1141631624 16:85291177-85291199 CAGCTCTGCTGAGAGACCCTGGG - Intergenic
1142016383 16:87750362-87750384 AAGCTGGGCTGCGTGACCCTGGG - Intronic
1142292563 16:89199728-89199750 CTGCTGGGCTGTGTCATCCTGGG - Exonic
1142424737 16:89995652-89995674 CGGCAGTGCTGAGTCATCCTTGG - Intergenic
1144163184 17:12581683-12581705 TATCTGTGCTGGCTGAGCCTGGG - Intergenic
1145884261 17:28371688-28371710 CGGCTGAGCTGGGAGATGCTCGG - Exonic
1146534549 17:33638947-33638969 CAGTTGTCCTGGGTGGTCATGGG + Intronic
1146945504 17:36870443-36870465 CAGCTCTGCTGTGTGACCTTGGG + Intergenic
1147128983 17:38394745-38394767 CAGCTGTTATGAGTGATGCTAGG + Intronic
1147256166 17:39183767-39183789 CAGCTGGGCTGGGTGATTGATGG + Exonic
1150137394 17:62703508-62703530 CCTCTGTGCTGGGTTCTCCTCGG + Intronic
1151323225 17:73363982-73364004 CAGCAGTTCTCGGTGAGCCTAGG - Intronic
1151522440 17:74640056-74640078 CAGCTGTGCAGGGTGGGTCTCGG - Intergenic
1152019555 17:77773218-77773240 CTGATGTGCTGAGTGATCTTGGG + Intergenic
1152026532 17:77813020-77813042 CAGCTTAGCTGGGTGGTTCTAGG - Intergenic
1153872528 18:9334465-9334487 CAGCTGGGGTGGGTGCGCCTGGG + Intergenic
1154356619 18:13626711-13626733 CAGCTGTGCTGGGTGGGGCCTGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156637807 18:39051951-39051973 CACCTGTGCTGGGCAATCATGGG - Intergenic
1157323807 18:46654920-46654942 CAGCTGGTCTGGCTGGTCCTTGG - Intronic
1157530473 18:48416219-48416241 CAGCAATCCTTGGTGATCCTTGG - Intergenic
1159586270 18:70286474-70286496 TAGCTGTGCTGGGTGTTGTTAGG + Intergenic
1159637383 18:70821469-70821491 CAGCAGTCATGGGTGTTCCTTGG + Intergenic
1160906216 19:1452874-1452896 CAGCCGTCCTGCCTGATCCTGGG - Exonic
1161167162 19:2794472-2794494 CAGCTCTGTTGGGTCCTCCTTGG + Intronic
1161348357 19:3778926-3778948 CAGCTCTGCTGTATGACCCTGGG - Intronic
1161377200 19:3946079-3946101 CAGCTCTGCTGGGTGACCTTGGG - Intergenic
1161398744 19:4058550-4058572 GAGCTGTGCTGGGTGACTCGGGG - Intronic
1161404694 19:4084735-4084757 CATCTGGGCTGGATGGTCCTCGG + Intergenic
1161493914 19:4577390-4577412 GTCCTGTGCTGGGTGATGCTAGG - Intergenic
1161650052 19:5478749-5478771 CAACTGTGCTGTGTGACCTTGGG - Intergenic
1161786126 19:6326749-6326771 CACCGCTGCTGGATGATCCTGGG - Intronic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1162040533 19:7968492-7968514 CAGCTCTGCTGTATGAGCCTGGG - Intronic
1162283503 19:9719572-9719594 CAGGTGTGCTGGGAAATCCAGGG - Intergenic
1162450466 19:10751263-10751285 CCTCTGTGCTGTGTGATCCTGGG - Intronic
1162981573 19:14243653-14243675 CAGCAATGCTGGGTGCTCCTTGG + Intergenic
1163127981 19:15254671-15254693 CAGCTGTGCTGAGAGACCCCCGG - Intronic
1164581976 19:29440183-29440205 CAACAGTGCTGGGGGATCCGGGG - Intergenic
1164845445 19:31428743-31428765 CAGGTTTGATGTGTGATCCTGGG + Intergenic
1165230604 19:34384185-34384207 CAGCTCTGGTGGGTGAGCCTGGG + Intronic
1165335688 19:35168199-35168221 AACCTGTGCTGGGTGATGCTGGG + Intronic
1165402701 19:35612093-35612115 ACCCTGTGCTGGGTGATGCTGGG - Intergenic
1166723012 19:45008453-45008475 CATCTGTGCTGGATGAACCTGGG - Intronic
1166872819 19:45881296-45881318 ACCCTGTGCTGGGTGATGCTGGG + Intergenic
925128417 2:1477602-1477624 CAGGTGCGCGGGGTGGTCCTGGG + Exonic
927195860 2:20546299-20546321 CAGCTTTGCTGAGTGATTCTGGG - Intergenic
928718473 2:34091295-34091317 CATCTGCTTTGGGTGATCCTGGG + Intergenic
928951180 2:36814308-36814330 CAAATGTTCTGGATGATCCTGGG - Exonic
929874570 2:45786038-45786060 CAGCCCTGCTGGGTCATCGTGGG + Intronic
931198074 2:60072115-60072137 CAGCTGTGATGTGTGATGCCTGG - Intergenic
931808084 2:65827454-65827476 CATCTGTGCTGAGTGATGGTGGG + Intergenic
932338115 2:70942634-70942656 CAGATGTGCTGTGTGGCCCTGGG + Intronic
932449697 2:71801747-71801769 CAGCTGGGCTGGGAAATCTTTGG + Intergenic
933678631 2:85079171-85079193 CAGCTGTGATGGGAGCGCCTGGG + Intergenic
933725314 2:85423688-85423710 CAGCTGTGATGGGTGATGAAGGG - Intronic
934119857 2:88828464-88828486 AGGCTGTGCTGGGTGCTCCTGGG + Intergenic
934718469 2:96556713-96556735 CTGCTGTGCTGGGTGACGCCAGG + Intergenic
935054971 2:99557786-99557808 AGGCTGTGCTGGGGGTTCCTGGG - Intronic
936163331 2:110101002-110101024 AGGCTGTGCTGGGTGCTCCTGGG + Intronic
936258289 2:110935530-110935552 CCGCACTGCTGGGTGGTCCTCGG - Intronic
936565736 2:113581350-113581372 CAGCTGGGCTGAGTGGGCCTGGG - Intergenic
937982153 2:127622150-127622172 GAGCTGTGCTGGGGGTCCCTGGG - Intronic
938554503 2:132412194-132412216 CAGCAGGCCTGGGTGATCCCAGG + Intergenic
940558766 2:155266599-155266621 CAACTGTGCAGAGTAATCCTGGG + Intergenic
941537982 2:166744948-166744970 CAGTTTTTCTGGGTGTTCCTTGG + Intergenic
944881391 2:204016629-204016651 CAGCTGTGGTTGGTGGTCTTTGG + Intergenic
945430311 2:209755766-209755788 CTGCTGTGCTGGAAGGTCCTAGG - Intergenic
945493340 2:210481120-210481142 CAGGTGTGCTGGGGTTTCCTTGG + Intronic
948224525 2:236298810-236298832 CAGCAATGCTGGGTGCTCCCTGG - Intergenic
948348486 2:237319223-237319245 CAGCTGTGCTGGCTGCTTCCAGG + Intergenic
1168789905 20:568952-568974 CAGCTCTGCTGTGTGAGCCCGGG + Intergenic
1168827201 20:821895-821917 CTACAGTGCTGAGTGATCCTGGG - Intergenic
1169849518 20:10034805-10034827 TAGCTGCGCTGGGTGTTCCAGGG - Intronic
1170573501 20:17646138-17646160 CTCCTGAGCTGGGTGGTCCTGGG + Intronic
1172115058 20:32568754-32568776 CAGCAGGGCTGGGTCATCATGGG - Intronic
1172330447 20:34072283-34072305 CAGCTGTGCTGGGAGAGAATGGG + Exonic
1172512064 20:35507788-35507810 CTGCTGTGCTGGTTGCACCTGGG - Exonic
1173576676 20:44116425-44116447 CACCACTGTTGGGTGATCCTGGG + Intronic
1174367568 20:50065663-50065685 AGGCAGTGCTGGGTGACCCTGGG - Intergenic
1175841515 20:62030802-62030824 CATCTGTGCTGTGTGGCCCTTGG - Intronic
1175978588 20:62725868-62725890 TTCCTGGGCTGGGTGATCCTGGG - Intronic
1176195655 20:63835484-63835506 CAGCTCTGGAGGGTGGTCCTGGG - Intergenic
1176270794 20:64234831-64234853 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176270835 20:64234951-64234973 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176270849 20:64234999-64235021 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176270946 20:64235306-64235328 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176271043 20:64235613-64235635 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176271082 20:64235733-64235755 TGGCTGTGGTGGGTGACCCTTGG + Intronic
1176271090 20:64235757-64235779 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176271110 20:64235829-64235851 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176271212 20:64236117-64236139 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176271246 20:64236213-64236235 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1176271254 20:64236237-64236259 TGGCTGTGGTGGGTGACCCTGGG + Intronic
1177802001 21:25836987-25837009 CAGCAGTTCTTGGTGCTCCTTGG + Intergenic
1178736137 21:35153754-35153776 CAGACCTGCTGGGTAATCCTGGG - Intronic
1179101304 21:38357497-38357519 CTGCTGAGCTGTGTGACCCTAGG + Intergenic
1179953926 21:44727459-44727481 CAGCTGTGCTGGGTGCAGCAAGG - Intergenic
1180181371 21:46120050-46120072 CAGCTGTGCGGGGTGTGCCTGGG - Intronic
1180931228 22:19593277-19593299 CACCTGTTCTGGGAGATGCTCGG + Intergenic
1181287565 22:21765169-21765191 CAGCTGTGCTCTGTGGTCCTGGG + Intronic
1181330781 22:22089043-22089065 CAGGTGTCCTGGGTTAACCTGGG - Intergenic
1181925579 22:26355950-26355972 CAGCTCTGCTGAGTGACCTTGGG + Intronic
1181985580 22:26798044-26798066 CAGCTGGGCTGGGTGACCTTGGG + Intergenic
1182092590 22:27605974-27605996 CAGTCTTGCTGTGTGATCCTAGG + Intergenic
1182709319 22:32310693-32310715 CAGCTGACCTGTGTGACCCTGGG + Intergenic
1183663245 22:39233692-39233714 CAGCTGTCCTGGGGGCTGCTTGG - Intronic
1184396902 22:44247609-44247631 CAGCTGACCTGTGTGATCCTGGG + Exonic
1184907379 22:47497926-47497948 CAGCAGAGCTGGGTCACCCTGGG - Intergenic
1185085278 22:48737553-48737575 ACACTGTGCTGGGTGAGCCTGGG + Intronic
1185372790 22:50468719-50468741 CTGCTGTGCTGTGTGAAGCTGGG - Intronic
950667425 3:14505857-14505879 CAGCTGTGCTGAGTGACCCTGGG + Intronic
950725995 3:14917408-14917430 CAGCTGGTCTGGGTGCTCCTGGG - Intronic
951051157 3:18095675-18095697 CAGCTCTGCTGTGTGATCTTGGG + Intronic
952859336 3:37799827-37799849 CCAATGAGCTGGGTGATCCTTGG - Intronic
953885104 3:46710551-46710573 CAGCTGTGCTGGGAGGTCCCAGG + Exonic
954628889 3:52037679-52037701 CAGCTGACCTGAGTGTTCCTAGG - Intergenic
955929261 3:64039438-64039460 CTGCTGTGCTGGGTGTTCGCAGG + Intergenic
956515973 3:70048293-70048315 CAGCTGTGTTATGTGATTCTGGG + Intergenic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
963409797 3:144912702-144912724 CAGCTCTGCTGGTAGAGCCTGGG - Intergenic
965567527 3:170136458-170136480 CAGCTGTGCTTCGTGATTCCAGG + Exonic
968406609 4:345165-345187 CATCTGTCCTTGGTGTTCCTGGG - Intronic
968507372 4:977107-977129 CAGCAGCCCTCGGTGATCCTTGG - Intronic
968552697 4:1231847-1231869 CAGCCGTGCTGAGGGAGCCTGGG - Intronic
968607984 4:1544590-1544612 CAGCAGCCCTCGGTGATCCTTGG - Intergenic
969084475 4:4645724-4645746 CTTATGTGCTGGGTGATCTTGGG - Intergenic
969249574 4:5958148-5958170 CATCTCTGGTGGGTGAGCCTGGG + Exonic
969390565 4:6889066-6889088 CACCTCTGCCGGGTGCTCCTGGG - Intergenic
969713191 4:8856077-8856099 CAGCTGTGCAGGTTGTTCATGGG + Intronic
970317060 4:14839417-14839439 CATCTGGGCTGGCAGATCCTTGG - Intergenic
970582879 4:17489574-17489596 CGGCTGTGCTGTGTGACCTTAGG + Intronic
970866523 4:20765362-20765384 CAGCTGTGATGGGTGCCTCTGGG - Intronic
972218475 4:36924206-36924228 CAGTTGTGGTGGGTGGGCCTTGG - Intergenic
976261453 4:83148800-83148822 AAGAGGTGCTGGGTAATCCTGGG + Intergenic
976700886 4:87967276-87967298 CAGCTGTCCTGGCTCATACTAGG - Intergenic
978809093 4:112830971-112830993 CAGCAGTGCTGGGGGACCCGGGG - Intronic
979819891 4:125158150-125158172 CAGCTTTGCAGGGTGATCCTAGG - Intergenic
983698298 4:170559803-170559825 CAGCTGAGGTGGGTGATGCCTGG + Intergenic
985631673 5:1017294-1017316 CAGTTGAGCTGGGTGCACCTGGG - Intronic
985794073 5:1949259-1949281 CAGGTGAGCTGGGTGCTCCTGGG + Intergenic
985876493 5:2602592-2602614 CAGCTGTGCTAGCAGTTCCTGGG - Intergenic
986126377 5:4885984-4886006 CAGCTCTGCTGAGTCCTCCTTGG - Intergenic
986307696 5:6528021-6528043 GAACTGTGCTGGGTGAGCCATGG + Intergenic
986667556 5:10116678-10116700 CAGCAGTGCTGGGGGCTCCTTGG - Intergenic
987153687 5:15066271-15066293 CACCAGTGCTTGGTGTTCCTAGG + Intergenic
988640142 5:33032800-33032822 GTGCTGTGCTGGGAGAACCTGGG - Intergenic
988994442 5:36701148-36701170 AAGCCGTCCTTGGTGATCCTGGG - Intergenic
990115613 5:52386957-52386979 CAGCTCTGCTGGATGGTTCTAGG + Intergenic
990350337 5:54909456-54909478 CAGCTTGGCTGTGTGACCCTGGG - Intergenic
990364261 5:55053766-55053788 CAGCTGTTCTGGGGGATGGTCGG - Intergenic
991174243 5:63668104-63668126 CTGCTGTGCTGGATGGTCTTAGG - Intergenic
991597052 5:68316505-68316527 CTGCTGTGCAGGGTCATTCTCGG - Intergenic
994321678 5:98401783-98401805 CAGCTGTGCTTTGTGCTCCCAGG - Intergenic
994500465 5:100570574-100570596 TAGCTGTTCTGGGAAATCCTTGG - Intronic
995005934 5:107195381-107195403 CAGCTGTAATGGATGATCATAGG - Intergenic
995867590 5:116707933-116707955 CAACTGGGCTGGGTGATACCGGG - Intergenic
996665024 5:126049260-126049282 CATCTGTGGTTGGTGATCCCTGG + Intergenic
997276773 5:132599795-132599817 CAACTCTGCTGGGTGACCTTAGG + Intronic
998104964 5:139462627-139462649 CAGCTGTGCTGGGTGATCCTGGG - Exonic
998140105 5:139694964-139694986 CAGCTGTCATGTGTGACCCTGGG + Intergenic
1001425542 5:171619782-171619804 CACTTATGCTGGGTGACCCTAGG + Intergenic
1002001873 5:176200587-176200609 GACCTGTGCTGGGGGATCCTGGG + Intergenic
1002007227 5:176245311-176245333 CAGCAGTCCTCGGTGTTCCTTGG - Intronic
1002219153 5:177665311-177665333 CAGCAGTCCTCGGTGTTCCTTGG + Intergenic
1002252464 5:177938391-177938413 GACCTGTGCTGGGGGGTCCTGGG - Intergenic
1002533694 5:179864567-179864589 CAGCTGGGGAGGGGGATCCTGGG + Intronic
1003301860 6:4891351-4891373 CAGCTGTGCCTGGTCATCCCAGG - Intronic
1006401197 6:33818473-33818495 CTGCTGTGCTGTGTGCTTCTTGG + Intergenic
1006638889 6:35478712-35478734 CAGCTCTGCTGTGTGATCTTGGG + Intronic
1007213555 6:40217971-40217993 AAGGTGTTCTGGGTGATCCAAGG - Intergenic
1009287252 6:61835382-61835404 CAGTTGTGTTGTGTGATCCCTGG + Intronic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1011679972 6:89773638-89773660 CAGCAGTCCTTGGTGTTCCTTGG - Intronic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1014561291 6:122893971-122893993 CAGCTGAGCAGGGTGGTGCTTGG - Intergenic
1016153119 6:140768864-140768886 TATCTGTGTTGGGTTATCCTTGG + Intergenic
1018062883 6:160104339-160104361 CAGCTGCGCTGGGGGATCACTGG + Intronic
1018920338 6:168168061-168168083 GGGCTGGGCTGGGTCATCCTGGG + Intergenic
1018964554 6:168474313-168474335 CAGCTGGGCTGGGGCTTCCTGGG + Intronic
1019355249 7:575263-575285 CGGCTGTGCTGGCTGAGGCTGGG + Intronic
1022037708 7:26549905-26549927 CGGCTGTGCTGCGTGCTCTTGGG + Intergenic
1023927377 7:44679500-44679522 GCGCTGTGCTGAGTCATCCTTGG - Intronic
1024026134 7:45411277-45411299 CAGCTGTCTTTGGTGTTCCTTGG + Intergenic
1026489130 7:70847720-70847742 CAGGTGTGCTGGGAGCTCCAGGG - Intergenic
1026586432 7:71659811-71659833 CAACTGTGCTGGCTGCCCCTGGG + Intronic
1029597463 7:101545396-101545418 CTGCTGGGCCGGGTGGTCCTGGG - Exonic
1032308594 7:130760065-130760087 CGGCTGTGCTGGGAGATTATAGG + Intergenic
1032802762 7:135329639-135329661 CAGCTGTCCTGAGAGATCCTGGG + Intergenic
1033184893 7:139218372-139218394 CAGCTGTGCTTGTTTAGCCTTGG - Intergenic
1033185236 7:139221121-139221143 CAGCTGTGCTTGTTTAGCCTTGG - Intergenic
1033308182 7:140239909-140239931 TGGCTTTGCTGGGTGATCCCTGG - Intergenic
1033551916 7:142455186-142455208 CTCCTCTGCTGGGTGGTCCTGGG + Intergenic
1033554190 7:142474108-142474130 CTCCTCTGCTGGGTGGTCCTGGG + Intergenic
1033556451 7:142492189-142492211 CTCCTATGCTGGGTGGTCCTGGG + Intergenic
1033558823 7:142511638-142511660 CTCCTATGCTGGGTGGTCCTGGG + Intergenic
1034856431 7:154552553-154552575 AAGCTGTGCTGGATGGTCCATGG + Intronic
1035104682 7:156432292-156432314 CAGCTGGGCGAGGTGATCCCAGG - Intergenic
1036770948 8:11578087-11578109 CAGCTGTGCTGGGAGCAGCTGGG - Intergenic
1037596528 8:20358804-20358826 CCGCTGTGATGGCTGATCTTAGG + Intergenic
1038610768 8:29058435-29058457 CACTTGTGCTGGGTGAGCCCAGG + Intronic
1039798512 8:40935161-40935183 CAGCTCTGCTGGGTCATCTTGGG + Intergenic
1040072545 8:43200341-43200363 CATCCCTGCTGGGTGATGCTGGG + Exonic
1042039449 8:64577124-64577146 GCGCTGGGCTGGGTGTTCCTCGG + Intergenic
1042790919 8:72605226-72605248 CAGCTGTGCTGTGTCAGGCTTGG - Intronic
1044616688 8:94149650-94149672 CAGCAGTGCTGGGGTATACTTGG + Intronic
1044844927 8:96371444-96371466 CAGGAGTTCTGGGTGTTCCTTGG + Intergenic
1046355428 8:113078228-113078250 CAGCTGTACTGAGTGGTTCTGGG + Intronic
1047223452 8:122937491-122937513 CAGCTGAGCTGGATGATTTTTGG - Intronic
1047901586 8:129428595-129428617 AAGCTGTTCTGAGTGATCATTGG - Intergenic
1048331709 8:133475226-133475248 CGGCAGTGCTGGGCGTTCCTGGG - Intronic
1048452825 8:134549064-134549086 AAGCTTTACTGGGTGACCCTGGG - Intronic
1048527259 8:135214474-135214496 CAGCAGTTCTTGGTGTTCCTGGG - Intergenic
1049446020 8:142631991-142632013 CAGCTGGGCTGGGTCATCTGAGG + Intergenic
1049507986 8:143013963-143013985 CAGCTGCCCTGTGTGCTCCTAGG - Intergenic
1049798165 8:144505808-144505830 CAGCAGTGCTGGGTGAGCCAAGG - Intronic
1050416153 9:5419458-5419480 CAGCTTCGCGGGGTGGTCCTGGG + Intronic
1051370943 9:16358535-16358557 CAGTTGTACTGGTTGATCTTGGG - Intergenic
1052084554 9:24248328-24248350 CAGCAATCCTGGGTGGTCCTTGG - Intergenic
1052820220 9:33132543-33132565 CAGCTGTGCTGGCTAACACTGGG - Intronic
1055402678 9:75941277-75941299 CAGCTGTGTGGGCTGATCCAGGG + Intronic
1057199367 9:93132205-93132227 CAGGTGTGTTGGGTGGTCCTGGG + Intronic
1057819087 9:98317501-98317523 CAGACTTGCTGGGTGATCTTGGG + Intronic
1058642664 9:107102389-107102411 CATCTTTGCTGTGTGAACCTAGG + Intergenic
1060671309 9:125472066-125472088 CTTCTGAGCTGGGTGATCTTAGG - Intronic
1060937301 9:127522885-127522907 CAGCTGTGCTGGGTGCTGGGTGG - Intronic
1061093137 9:128438467-128438489 CCTCTGTGCTGGGTGATCTTGGG + Intergenic
1061375594 9:130222616-130222638 CAGCACTGCTGAGTGATCCTGGG - Intronic
1061885408 9:133588771-133588793 CAGATGTGCCCGGTGACCCTGGG - Intergenic
1062190171 9:135243894-135243916 CAGCTCTGCTGGGGAAGCCTGGG + Intergenic
1062521919 9:136961507-136961529 CAGCTGAGCTGGGCGGCCCTGGG - Intergenic
1186443843 X:9608824-9608846 CAGCTGAGGTGGGAGATCCCAGG + Intronic
1186694723 X:12018279-12018301 CAGCTATCCTTGGTGTTCCTTGG + Intergenic
1187189639 X:17021609-17021631 CAGATGAGTTGTGTGATCCTGGG + Intronic
1188669079 X:32861057-32861079 CAGCTCTGCAGTGTGATCTTGGG + Intronic
1188911618 X:35854796-35854818 CAGCTGTCCTTGGTGATTCCTGG - Intergenic
1189235023 X:39480167-39480189 CAGCTTGGGTGGGAGATCCTGGG + Intergenic
1190054388 X:47173421-47173443 GAGCTGAGCTGGGTGCTCCCTGG + Intronic
1191108787 X:56789167-56789189 TAGGTGAGGTGGGTGATCCTTGG - Intergenic
1191610079 X:63102610-63102632 CAGCTGTGCAGGGTGCTAGTGGG - Intergenic
1195154853 X:102112714-102112736 CACATGTGCTGATTGATCCTGGG + Intergenic
1197785181 X:130191244-130191266 CAGATGTGCTGAGAGATCCCTGG + Intergenic
1199403688 X:147430280-147430302 AAGCTGTTCTGGGTGAACTTGGG - Intergenic
1199587505 X:149431747-149431769 CAGCTGAGCTTGGTGATGATGGG + Intergenic