ID: 998105451

View in Genome Browser
Species Human (GRCh38)
Location 5:139466128-139466150
Sequence GTTGTAGTGAGCCGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998105451_998105454 -9 Left 998105451 5:139466128-139466150 CCTGCCTCTCGGCTCACTACAAC No data
Right 998105454 5:139466142-139466164 CACTACAACCTCCACCTCCTGGG No data
998105451_998105453 -10 Left 998105451 5:139466128-139466150 CCTGCCTCTCGGCTCACTACAAC No data
Right 998105453 5:139466141-139466163 TCACTACAACCTCCACCTCCTGG No data
998105451_998105460 30 Left 998105451 5:139466128-139466150 CCTGCCTCTCGGCTCACTACAAC No data
Right 998105460 5:139466181-139466203 GACTCAGCCTCCCGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998105451 Original CRISPR GTTGTAGTGAGCCGAGAGGC AGG (reversed) Intergenic