ID: 998109014

View in Genome Browser
Species Human (GRCh38)
Location 5:139486849-139486871
Sequence GGGGCAAGTAAGCATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998109006_998109014 15 Left 998109006 5:139486811-139486833 CCAGGCAGTGGAGGAACAGAGCA No data
Right 998109014 5:139486849-139486871 GGGGCAAGTAAGCATGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998109014 Original CRISPR GGGGCAAGTAAGCATGTGGA GGG Intergenic
No off target data available for this crispr