ID: 998113937

View in Genome Browser
Species Human (GRCh38)
Location 5:139522438-139522460
Sequence GCCTGAGCTACCTCCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113937_998113941 -8 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113941 5:139522453-139522475 GCTCAGGCCCCTAGGGTGCCAGG No data
998113937_998113952 18 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data
998113937_998113954 23 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113954 5:139522484-139522506 AGGGGGCCCATCTGGTGGAAAGG No data
998113937_998113948 5 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113948 5:139522466-139522488 GGGTGCCAGGGAATACCAAGGGG No data
998113937_998113955 24 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113955 5:139522485-139522507 GGGGGCCCATCTGGTGGAAAGGG No data
998113937_998113951 15 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data
998113937_998113956 25 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data
998113937_998113947 4 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113947 5:139522465-139522487 AGGGTGCCAGGGAATACCAAGGG No data
998113937_998113949 6 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113949 5:139522467-139522489 GGTGCCAGGGAATACCAAGGGGG No data
998113937_998113942 -7 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113942 5:139522454-139522476 CTCAGGCCCCTAGGGTGCCAGGG No data
998113937_998113946 3 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113946 5:139522464-139522486 TAGGGTGCCAGGGAATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113937 Original CRISPR GCCTGAGCTACCTCCTTTGG AGG (reversed) Intergenic
No off target data available for this crispr