ID: 998113938

View in Genome Browser
Species Human (GRCh38)
Location 5:139522441-139522463
Sequence GGGGCCTGAGCTACCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113938_998113954 20 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113954 5:139522484-139522506 AGGGGGCCCATCTGGTGGAAAGG No data
998113938_998113959 29 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113959 5:139522493-139522515 ATCTGGTGGAAAGGGGTCCCTGG No data
998113938_998113955 21 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113955 5:139522485-139522507 GGGGGCCCATCTGGTGGAAAGGG No data
998113938_998113942 -10 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113942 5:139522454-139522476 CTCAGGCCCCTAGGGTGCCAGGG No data
998113938_998113948 2 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113948 5:139522466-139522488 GGGTGCCAGGGAATACCAAGGGG No data
998113938_998113946 0 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113946 5:139522464-139522486 TAGGGTGCCAGGGAATACCAAGG No data
998113938_998113947 1 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113947 5:139522465-139522487 AGGGTGCCAGGGAATACCAAGGG No data
998113938_998113951 12 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data
998113938_998113949 3 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113949 5:139522467-139522489 GGTGCCAGGGAATACCAAGGGGG No data
998113938_998113952 15 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data
998113938_998113956 22 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113938 Original CRISPR GGGGCCTGAGCTACCTCCTT TGG (reversed) Intergenic