ID: 998113941

View in Genome Browser
Species Human (GRCh38)
Location 5:139522453-139522475
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113937_998113941 -8 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113941 5:139522453-139522475 GCTCAGGCCCCTAGGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type