ID: 998113942

View in Genome Browser
Species Human (GRCh38)
Location 5:139522454-139522476
Sequence CTCAGGCCCCTAGGGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113937_998113942 -7 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113942 5:139522454-139522476 CTCAGGCCCCTAGGGTGCCAGGG No data
998113938_998113942 -10 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113942 5:139522454-139522476 CTCAGGCCCCTAGGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113942 Original CRISPR CTCAGGCCCCTAGGGTGCCA GGG Intergenic
No off target data available for this crispr