ID: 998113947

View in Genome Browser
Species Human (GRCh38)
Location 5:139522465-139522487
Sequence AGGGTGCCAGGGAATACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113938_998113947 1 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113947 5:139522465-139522487 AGGGTGCCAGGGAATACCAAGGG No data
998113937_998113947 4 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113947 5:139522465-139522487 AGGGTGCCAGGGAATACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113947 Original CRISPR AGGGTGCCAGGGAATACCAA GGG Intergenic
No off target data available for this crispr