ID: 998113951

View in Genome Browser
Species Human (GRCh38)
Location 5:139522476-139522498
Sequence GAATACCAAGGGGGCCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113937_998113951 15 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data
998113938_998113951 12 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data
998113943_998113951 -7 Left 998113943 5:139522460-139522482 CCCCTAGGGTGCCAGGGAATACC No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data
998113944_998113951 -8 Left 998113944 5:139522461-139522483 CCCTAGGGTGCCAGGGAATACCA No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data
998113945_998113951 -9 Left 998113945 5:139522462-139522484 CCTAGGGTGCCAGGGAATACCAA No data
Right 998113951 5:139522476-139522498 GAATACCAAGGGGGCCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113951 Original CRISPR GAATACCAAGGGGGCCCATC TGG Intergenic
No off target data available for this crispr