ID: 998113952

View in Genome Browser
Species Human (GRCh38)
Location 5:139522479-139522501
Sequence TACCAAGGGGGCCCATCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113938_998113952 15 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data
998113937_998113952 18 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data
998113943_998113952 -4 Left 998113943 5:139522460-139522482 CCCCTAGGGTGCCAGGGAATACC No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data
998113944_998113952 -5 Left 998113944 5:139522461-139522483 CCCTAGGGTGCCAGGGAATACCA No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data
998113945_998113952 -6 Left 998113945 5:139522462-139522484 CCTAGGGTGCCAGGGAATACCAA No data
Right 998113952 5:139522479-139522501 TACCAAGGGGGCCCATCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113952 Original CRISPR TACCAAGGGGGCCCATCTGG TGG Intergenic
No off target data available for this crispr