ID: 998113956

View in Genome Browser
Species Human (GRCh38)
Location 5:139522486-139522508
Sequence GGGGCCCATCTGGTGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998113945_998113956 1 Left 998113945 5:139522462-139522484 CCTAGGGTGCCAGGGAATACCAA No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data
998113938_998113956 22 Left 998113938 5:139522441-139522463 CCAAAGGAGGTAGCTCAGGCCCC No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data
998113937_998113956 25 Left 998113937 5:139522438-139522460 CCTCCAAAGGAGGTAGCTCAGGC No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data
998113944_998113956 2 Left 998113944 5:139522461-139522483 CCCTAGGGTGCCAGGGAATACCA No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data
998113943_998113956 3 Left 998113943 5:139522460-139522482 CCCCTAGGGTGCCAGGGAATACC No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data
998113950_998113956 -8 Left 998113950 5:139522471-139522493 CCAGGGAATACCAAGGGGGCCCA No data
Right 998113956 5:139522486-139522508 GGGGCCCATCTGGTGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998113956 Original CRISPR GGGGCCCATCTGGTGGAAAG GGG Intergenic
No off target data available for this crispr