ID: 998114194

View in Genome Browser
Species Human (GRCh38)
Location 5:139523957-139523979
Sequence CTATTGATACAGAAGGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998114181_998114194 30 Left 998114181 5:139523904-139523926 CCAGTTGTGTGGCGGGAGGGCAG No data
Right 998114194 5:139523957-139523979 CTATTGATACAGAAGGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998114194 Original CRISPR CTATTGATACAGAAGGACGG GGG Intergenic
No off target data available for this crispr