ID: 998116713

View in Genome Browser
Species Human (GRCh38)
Location 5:139543421-139543443
Sequence AGGGAAGCTGGGCCCACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116713_998116725 18 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116713_998116722 14 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116722 5:139543458-139543480 ATCCTGGATTGCACGTCAGTAGG No data
998116713_998116719 -2 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116719 5:139543442-139543464 CTCTATACCCACGTAGATCCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
998116713_998116724 17 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116713_998116726 27 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116713 Original CRISPR AGGGAAGCTGGGCCCACGGA AGG (reversed) Intronic
901212539 1:7534675-7534697 AGGGGAGCTGAGGCCACGGCGGG + Intronic
901769847 1:11524651-11524673 AGGGATGGTGGGCACAGGGATGG - Intronic
902391810 1:16111276-16111298 AGGGAAGATGGGCCTCCAGAGGG - Intergenic
902619914 1:17644752-17644774 AGGGCAGCTGAGCCCACCGCGGG - Intronic
902659282 1:17890200-17890222 AGGGCACCTGGGGCCATGGAGGG + Intergenic
902731960 1:18375596-18375618 AGGGAGGCTGTGCACAAGGAAGG + Intronic
903327848 1:22581519-22581541 AGGGAAGCGGAGCCCAGAGAGGG + Intronic
903643015 1:24872544-24872566 AGTGCAGCTGGGCCCAGGGTGGG + Intergenic
904028478 1:27519647-27519669 AGGGGAGGCGGGGCCACGGAGGG - Intergenic
904213018 1:28898163-28898185 AGGGAAGTAGGGCCCACGTCAGG + Intronic
905394005 1:37655753-37655775 AGGGAATCTGAGCCCCAGGAAGG - Intergenic
906240324 1:44238681-44238703 TGGTAAGATGGGCCCATGGAAGG + Intronic
906678233 1:47708615-47708637 AGGGATGCCGTGCCCAGGGAGGG + Intergenic
908302938 1:62780008-62780030 AGGAAAGCTGAGTCCACTGAAGG + Intergenic
912753942 1:112308833-112308855 AGGGAAGCAGGGCCCAGGAGTGG + Intergenic
913334596 1:117697527-117697549 AAAGAAGCTGGGGCCATGGATGG + Intergenic
915528574 1:156490561-156490583 AGGAAAGCTGGGCCTAGGGCAGG + Intronic
915544145 1:156586387-156586409 AGGGAAGCTGAGGCCAAGGCAGG + Intronic
916029251 1:160862178-160862200 AGGAAAGCTGAGCCCAGGGAGGG - Intronic
917669346 1:177257465-177257487 AGGTCAGCTGGGCCGACTGATGG + Intronic
920114827 1:203613026-203613048 AGGGCAGCTGAGGCCATGGAGGG - Intergenic
920875894 1:209835281-209835303 AGGGAAGCAGGGCATAAGGAAGG + Intronic
921551131 1:216536913-216536935 AGGGAAAATGGGCCCTGGGATGG + Intronic
922334012 1:224604579-224604601 AGGGAGGCTGGAGCCAGGGATGG + Intronic
924004340 1:239591242-239591264 AGAGAAGCTTGACCCAAGGAAGG - Intronic
1063294526 10:4791266-4791288 AGGGAAGCAGGAGCCAAGGAGGG - Intronic
1065245037 10:23748146-23748168 AGGGAGGCTGGGCCAAGGGGAGG - Intronic
1069624129 10:69856999-69857021 AGGGACAGTGGGCCCAGGGAAGG - Intronic
1069822482 10:71236322-71236344 AGGGATGCTGGGGGCAGGGAAGG - Intronic
1070846111 10:79523835-79523857 AGGGAGCCTGGGCCCTGGGAGGG + Intergenic
1070927687 10:80236475-80236497 AGGGAGCCTGGGCCCTGGGAGGG - Intergenic
1072017166 10:91359773-91359795 AGGGAAGCCAGGACCACTGATGG + Intergenic
1073132159 10:101196482-101196504 AGGGAAGATCAGCCCAGGGAGGG + Intergenic
1073291119 10:102413830-102413852 AGCCAAGCTGGCCCCAGGGAGGG - Exonic
1075150720 10:119927872-119927894 AGGGTAGCTGGGCCAAAGGATGG + Intronic
1075389870 10:122084415-122084437 GGGGGTGCTGGGCACACGGACGG + Exonic
1075394105 10:122114107-122114129 ATGGAAGCGGGGCCTAAGGAGGG + Intronic
1075806589 10:125193523-125193545 AGGAAAGCTGCGAGCACGGAGGG - Intergenic
1076119291 10:127922823-127922845 AGGGAAGATGGGAGCAGGGAGGG - Intronic
1076219603 10:128722648-128722670 AGGAAAGCTGGCCCTTCGGATGG + Intergenic
1076364927 10:129915638-129915660 GGGAAAGCTGTGCCCACAGATGG + Intronic
1076481810 10:130789641-130789663 GGGGAAGTAGGACCCACGGAAGG - Intergenic
1076675147 10:132143826-132143848 AGGGAAACGGAGCCCACAGAGGG - Intronic
1076688202 10:132207716-132207738 CGGGGAGCTGGGGCCATGGATGG - Exonic
1077259625 11:1609046-1609068 AGGCAAGCTGGGCTCACAGAGGG + Intergenic
1077407312 11:2388451-2388473 AGGGAAGCAGGGCCCCAGGGTGG - Intronic
1077482770 11:2824279-2824301 AGGGAGGCTAGGCCCAGGGGTGG + Intronic
1077488893 11:2851448-2851470 GGGGAAGCTGGGCTCATGGCGGG - Intergenic
1077538339 11:3134956-3134978 GGAGAAGCTCGGCCCATGGAAGG + Intronic
1077589361 11:3479753-3479775 AGGGAAGGGGGGCCCTGGGAAGG - Intergenic
1077999339 11:7480968-7480990 ATGAAAGCTGTGCCCAAGGAGGG - Intergenic
1078669540 11:13352819-13352841 AGGGAAGTTGGGTCCAGAGAGGG + Intronic
1079817545 11:25080741-25080763 AGGGAAGTTGGGCCCCAGGGTGG - Exonic
1080596512 11:33778327-33778349 AGGGAAGCTGGGGGCTGGGATGG + Intergenic
1082760613 11:57123745-57123767 ACGGAAGCTGGGCCCTAGGGTGG + Intergenic
1083193064 11:61066450-61066472 AGGGAAGCAAGGCCCAGAGAGGG + Intergenic
1083261873 11:61527575-61527597 AGGGAAGCTGGGCCACCGCCTGG - Intronic
1083697059 11:64449930-64449952 CAGGAAGCTGGCCCCAAGGACGG + Exonic
1083764306 11:64834779-64834801 AGGGATGCTGAGCTCACGGAAGG + Intronic
1084319835 11:68367146-68367168 AGAGAAACTGGACCCAGGGAAGG + Intronic
1084657841 11:70529310-70529332 TGGGAGGCTGGGCCCAGAGAAGG + Intronic
1084799981 11:71537371-71537393 AGGCAAGCTGGGCTCACAGAGGG - Intronic
1084827609 11:71743050-71743072 AGGGAAGGGGGGCCCCGGGAAGG + Intergenic
1085018299 11:73189559-73189581 ATGCAAGCAGGGGCCACGGAGGG + Intergenic
1085402605 11:76243596-76243618 AGGGAAGAGGTGCCCAGGGACGG + Intergenic
1087078115 11:94144405-94144427 ACAGAAGCTGGACCCATGGAAGG - Intronic
1088212155 11:107468688-107468710 AAGGAATCTGGGCCCCTGGATGG - Intergenic
1088352110 11:108901070-108901092 AGGGAGGCTAGGCCAACAGAAGG - Intronic
1088912006 11:114199155-114199177 ACGGATGCTGGGCCCCGGGACGG + Intronic
1088912098 11:114199408-114199430 ATGGATGCTGGGCCCCGGGATGG + Intronic
1090246837 11:125222164-125222186 GAGGAAGCTGAGCCCACAGAGGG + Intronic
1090266605 11:125357107-125357129 AGGGAAGGTGGGCCCTCATATGG - Intronic
1091692822 12:2608735-2608757 AGGGAAGCGGGGCCCACGGAGGG + Intronic
1091782179 12:3220793-3220815 TGGGAAGGCGGGCCCAAGGAGGG + Intronic
1092415653 12:8288658-8288680 AGGGAAGGGGGGCCCCGGGAAGG - Intergenic
1092916517 12:13194436-13194458 AGAGACGCTGGGCTCAGGGACGG - Intergenic
1095957807 12:47816834-47816856 AGGGGAGCTGGACGCCCGGAAGG - Intronic
1096538486 12:52290040-52290062 AGGGATGCTGGGCACAGGAATGG - Intronic
1096540293 12:52303324-52303346 AGGGATGCTGGGCACAGGAATGG + Intronic
1096672905 12:53210884-53210906 AGAGCAGCTTGGCCCAGGGAGGG - Exonic
1100396273 12:94188841-94188863 AGGGACTCTGGGCCCAAGCATGG + Intronic
1101875721 12:108595927-108595949 AGGGCAGCTGGGACCATGGGTGG + Intronic
1101949885 12:109166552-109166574 TGGGTAGCTGGGACCACAGAGGG - Intronic
1103907335 12:124334522-124334544 GGGGCAGCTGGCCCCAGGGAAGG + Exonic
1104415714 12:128595466-128595488 GGGGAAGCTGGGCCCAGGGAGGG + Intronic
1104682324 12:130760475-130760497 AGGGAAGTGGGTCCCACTGAAGG + Intergenic
1104953949 12:132454768-132454790 AGGGACGCTGGGCAGAGGGAGGG - Intergenic
1108510238 13:51148921-51148943 AGGGAAGCCTGGCCCCAGGAAGG - Intergenic
1112494462 13:99894208-99894230 AGGGTACCTGGGCCCACCCATGG - Exonic
1113741214 13:112713875-112713897 AGGGAGGCTGGGGCCAGGAATGG - Intronic
1113767939 13:112892679-112892701 GGGGAGGCTGGGCTCAGGGAAGG - Intergenic
1114050477 14:18916658-18916680 ATGGGAGCTGGGCCCAGGCAAGG + Intergenic
1114112080 14:19485274-19485296 ATGGGAGCTGGGCCCAGGCAAGG - Intergenic
1117392212 14:55272174-55272196 CGGGGACCTGGGCTCACGGAAGG + Intronic
1118725441 14:68625597-68625619 CGAGTAGCTGGGCCCACAGAAGG + Intronic
1122059772 14:99129279-99129301 AGGGAAGCAAGGCCCAGAGATGG - Intergenic
1122246287 14:100405523-100405545 AGGGAGGCTGGGCCCCCTGGAGG + Intronic
1122769804 14:104092933-104092955 AGGGAAGGTGGGACCAGGCACGG - Intronic
1122960029 14:105090048-105090070 AGGCAAGCTGGGGCCCAGGAGGG + Intergenic
1125280997 15:38042675-38042697 GGGGAAGCTGAGCCCACAGAAGG + Intergenic
1125886959 15:43236418-43236440 AGGGAAGCTGGGGCCACCCTGGG - Intronic
1126848524 15:52784148-52784170 AGGGAAGCAGGGAGCGCGGAGGG + Intronic
1130543321 15:84837708-84837730 AGGGCAGCTGTGCCCAGGCAAGG + Intronic
1131212558 15:90510393-90510415 TGGGAAGCTGGCCACATGGACGG + Intergenic
1134616839 16:15658086-15658108 AGGAAAGCTGGGCCAAGGGATGG - Intronic
1135899284 16:26441899-26441921 AGAGAAGCTGAGGCCACGGATGG + Intergenic
1136567788 16:31080424-31080446 AGGGAAGCTGCGGCCACAGAGGG - Exonic
1136630999 16:31489213-31489235 AGGAAAGCTGGGCACGCCGAGGG - Exonic
1138514966 16:57530923-57530945 AGGGAAGCAGGTGCCACGGTGGG - Intronic
1140256949 16:73345858-73345880 AGGGAAGCAGGGCCCTGGGCTGG - Intergenic
1140410301 16:74737135-74737157 AGGGAGGCTGGTCCCCCGGGTGG + Intronic
1140457629 16:75114279-75114301 AGGGAAACTGGGCCCGAGGGAGG - Intronic
1141476768 16:84279326-84279348 AGTAAAGCTGGGGCCACGGAGGG - Intergenic
1141615336 16:85206811-85206833 AGGGAAGCTGGGCTGGCGGGGGG - Intergenic
1141644982 16:85362522-85362544 AGAGCAGCTGAGCCCAGGGAAGG - Intergenic
1141820328 16:86441404-86441426 ATGGAAGCTGAGCCCAGGAACGG - Intergenic
1142696779 17:1638399-1638421 AGGAGGGCTGGGACCACGGAAGG - Intronic
1143265280 17:5632287-5632309 AGGGAAGCTGGTCCCATTAAGGG - Intergenic
1143415303 17:6743778-6743800 ATGGAAGCAGGGCCTACAGATGG - Intergenic
1143845952 17:9772732-9772754 AGGGAAGCTGGGGCCCCTGGGGG - Intronic
1143976857 17:10836749-10836771 TGGGAGGCTGGGCCCAGCGAGGG + Intronic
1144780128 17:17803908-17803930 TGGGGAGCTGTGCCCAGGGAGGG - Intronic
1146057866 17:29589915-29589937 GGGGACGCTGGGCCCACGGACGG + Intronic
1146255859 17:31391403-31391425 AGGGAAACTGGGGACGCGGAGGG + Intergenic
1147241001 17:39090477-39090499 AAAGAAGCTCGGCCCCCGGAGGG + Intronic
1147786018 17:42979515-42979537 TGGGAAGCCAGGCCCTCGGACGG + Intronic
1148127036 17:45242270-45242292 AGGGAACCTGGGCCCAGGGAGGG - Intronic
1151223949 17:72634768-72634790 ATGGAAGCTGAGCTCACGGTGGG + Intergenic
1151578235 17:74963449-74963471 AGAGGAGCTGGGCCCTCTGAGGG - Intronic
1151651815 17:75474954-75474976 AGGGAGGCAGGGCCCAGAGAGGG + Intronic
1152082780 17:78198880-78198902 AGGGGAACTGGGCACACGAAAGG - Intronic
1152554260 17:81045288-81045310 AGGGAAGCAGGGCCCCAGGCTGG + Intronic
1152923849 17:83079014-83079036 AGGGAAGCCGGGCTCACCGCCGG + Intergenic
1153617475 18:6947900-6947922 AGGGGAGCTGAGGCCATGGAGGG + Intronic
1154010830 18:10572426-10572448 TGGGAAGCTGGGCCTGAGGATGG + Intergenic
1156502704 18:37569675-37569697 AGGGAAGCTGAGCCCAGTGAGGG - Intergenic
1157033737 18:43945796-43945818 AGGGAAACTAGGCCCATAGAGGG + Intergenic
1157099971 18:44720594-44720616 AGGGAGGTTAGGCCCACGCATGG + Intronic
1157445064 18:47738279-47738301 AGGGAAGCTGAGCCCTCTCATGG + Intergenic
1157713349 18:49865225-49865247 GAGGAAGCTGAGCCCAGGGAGGG + Intronic
1157863849 18:51164545-51164567 AGGGAAGCTGTGGCCAAGAATGG + Intergenic
1158961510 18:62591436-62591458 AGGGAAGTTCAGCCCACGGAGGG + Intergenic
1159917529 18:74200062-74200084 AGGCAGGATGGGCCCAAGGAGGG + Intergenic
1160168412 18:76532524-76532546 TGGGCAGGTGGGCCCACAGATGG + Intergenic
1160560161 18:79751048-79751070 AGGGAGGCTGGGCACACAGAGGG + Intronic
1160560173 18:79751085-79751107 AGGGAGGCTGGGCACACAGAGGG + Intronic
1160710652 19:549557-549579 AGGGGAGCAGGGCCCGCCGAGGG - Intronic
1160894150 19:1394980-1395002 AGGGAGGCTGGGCGGAGGGAGGG - Intronic
1161234143 19:3189743-3189765 AGGGAGGCTGGGGCCACCCAAGG + Intronic
1161488341 19:4547966-4547988 AGGGAGGATGGGCACAGGGAGGG - Intronic
1161593073 19:5137426-5137448 AAGGAACCCAGGCCCACGGAGGG - Intronic
1162918856 19:13888791-13888813 AGAGAAGCTGGGCCTGGGGATGG - Intronic
1163086011 19:14979963-14979985 AGGGATGCTGGGGCCTCCGAGGG - Intronic
1163155279 19:15436864-15436886 AGGTAAGCGGGGCCGACGGGAGG + Exonic
1163636285 19:18438448-18438470 AGGGAAGCTGGGCCTCCGGGGGG + Intergenic
1164870053 19:31635561-31635583 AGGGAAGCTGATCCCTCAGATGG + Intergenic
1165486852 19:36101574-36101596 GGGGAAACTGAGCCCAGGGAAGG + Intronic
1166023474 19:40055552-40055574 AGGGAAGTTGTGGCCATGGAGGG - Intronic
1166742212 19:45121451-45121473 AGGACAGCTGGGCCCTCGCATGG + Intronic
1167566262 19:50259146-50259168 CGGGAAGCTGGAGCCACGGCTGG + Exonic
926163022 2:10501554-10501576 AGGCCAGCTGTGCCCATGGAGGG - Intergenic
932214686 2:69959052-69959074 AGGGAAGAAGGGGCCAGGGACGG + Intergenic
932334261 2:70920932-70920954 AAGGAATCTGGGCCCAGAGAGGG + Intronic
932347956 2:71007791-71007813 AGAGGAGCTGGGCCTAGGGAGGG + Intergenic
932478686 2:72025032-72025054 AGGGGAGAAGGGCCCACGGCAGG - Intergenic
933321159 2:80777279-80777301 AGAGAAGCTGGGGACAGGGAGGG + Intergenic
933707499 2:85302908-85302930 AGGGAAGCACGGCCCACAGCTGG - Intronic
934554156 2:95278606-95278628 AGGGAAACTGGGAGCACTGAGGG + Intronic
938263655 2:129911745-129911767 AGGGAGGCTGGGGCCTGGGAAGG - Intergenic
938759730 2:134412890-134412912 AGGGGAGCTGGGCCCTCGTAAGG - Exonic
938792140 2:134686129-134686151 AGGGCAGCTGGGTTCAGGGAAGG - Intronic
938827840 2:135023942-135023964 AAAGAAACTGGGCCCATGGAGGG - Intronic
941362142 2:164564285-164564307 AGGGAAGCTGGGCAGGCTGAGGG + Intronic
942401641 2:175609442-175609464 AAGGAAGCTGGGCCGAAGGCAGG - Intergenic
943327981 2:186524588-186524610 AGGGAAGCTGGGGCCACCAGAGG - Intergenic
944865318 2:203854236-203854258 TGGGAAGGTGGGCCCACAGATGG - Intergenic
946195774 2:218032480-218032502 AGAGATGCTGGGCCTACGGCAGG + Intergenic
947109055 2:226699026-226699048 GGGGAGGGTGGGCCCAAGGAGGG + Intergenic
947547004 2:231017302-231017324 AGGGAAGCTGATACCACGGAAGG - Intronic
947772434 2:232681459-232681481 AGGGAATGTGGGCCCACGGAGGG - Intronic
948459420 2:238121951-238121973 AGAGAATCACGGCCCACGGATGG - Intronic
948545148 2:238722938-238722960 AGGGAAGGGGGGCCCACGCATGG + Intergenic
948876361 2:240831859-240831881 AGGGGAGCTGGGTCCAGGCAGGG + Intergenic
949057592 2:241936871-241936893 CGGGACGCTGGGCCCGCGTAGGG + Intergenic
1168953903 20:1820943-1820965 GGGGAAGCTGGGCCCAAGGAAGG - Intergenic
1169067330 20:2701416-2701438 AGGGATGCTGAGCCCTGGGAAGG + Intronic
1169140120 20:3223089-3223111 AGGGAAGCTGGGGACAGGGGGGG - Intronic
1169539252 20:6581444-6581466 AGGGATGTTGGGTCCACGAAGGG + Intergenic
1170888228 20:20357935-20357957 AGGGAAGGTGGTCACACTGAGGG + Intronic
1171410400 20:24943300-24943322 AGGGAAGCTGTGCCCCAGGTGGG - Intergenic
1171481520 20:25458952-25458974 AGGGAAGGTGGGGCCAGGGCTGG + Intronic
1172447911 20:35002754-35002776 AGGGAGGCTTGGCTCACAGATGG + Exonic
1175086538 20:56464265-56464287 AGGGAAGATGGCTCCAAGGAAGG + Intergenic
1176038131 20:63050196-63050218 AGGGAAGCCCGGCCCAGGGCAGG + Intergenic
1176073146 20:63237069-63237091 AGGGCAGCAGGGCCCACCGAGGG + Intronic
1176147677 20:63572695-63572717 AGGGCAGCGGGGCCCAGGGAGGG - Intronic
1176840512 21:13838547-13838569 AGGGACTCTGGGCACTCGGAGGG + Intergenic
1179574504 21:42299419-42299441 TGGGAAGCTGTGCCCAGGAAGGG + Intergenic
1180468953 22:15639032-15639054 ATGGGAGCTGGGCCCAGGCAAGG + Intergenic
1180641610 22:17303756-17303778 AGGGAAGCTGGGACCAGGAAGGG + Intergenic
1180700401 22:17778418-17778440 AGGGAAGCAGAGCCCATGGCTGG + Intergenic
1180715083 22:17866135-17866157 AAGAAAGCTGGGCCCAGGGAAGG - Intronic
1181049266 22:20231035-20231057 GGGGAAGCTGGGCCCAGGAGAGG - Intergenic
1182091327 22:27596887-27596909 AGAGGAGCAGGGCCCATGGAGGG - Intergenic
1182118844 22:27774078-27774100 GGGGAATCTGGGCACACGGGAGG - Intronic
1182989375 22:34752299-34752321 AGGTAAGCAGGGCCCAGGGGAGG - Intergenic
1183073383 22:35411598-35411620 AGGGCAGCAGGGGCCACTGAGGG + Intronic
1183418673 22:37697502-37697524 AGAGACCCTGGGGCCACGGAAGG + Intronic
1183586560 22:38756133-38756155 AGGGCAGCGGGGCCCACGCGAGG - Intronic
1184240917 22:43210878-43210900 TGGGAAGCTGGGAACACGGGAGG - Intronic
1184402122 22:44280374-44280396 AGTGAACTTGGGCCCAGGGAGGG - Intronic
1184587962 22:45460538-45460560 ATGGAAGCTGGGCCCGGGGAAGG - Intergenic
950412963 3:12850911-12850933 AGGGAAGCTGGGCCCTTTGCTGG + Intronic
950440463 3:13007370-13007392 GGGGCAGCTGGGCCCACAGCTGG - Intronic
950583476 3:13878138-13878160 CGGGCAGCTGGGCCCCCGCAGGG + Intronic
952803093 3:37316157-37316179 AAGGAAGCTGGGAGCAGGGAGGG - Intronic
953389691 3:42527055-42527077 AGGGAAGCCGGGCACATGGCTGG + Intronic
954369817 3:50164238-50164260 AGGGAAGCTGGAGCCAGGGAAGG - Intronic
956673798 3:71716037-71716059 ACAGTAGGTGGGCCCACGGAGGG - Intronic
956883734 3:73537244-73537266 AGGGAAGGTGGGGCCACAGATGG + Intronic
959414500 3:106067711-106067733 AGAGCAGCTGGGGCCACGTAGGG + Intergenic
960585039 3:119313204-119313226 AGAGAAGCTGGGGACAGGGATGG - Intronic
961431460 3:126886890-126886912 AGGGAAGCTGGGGCTTCTGATGG - Intronic
961649170 3:128408870-128408892 TGGGCAGCTGGGTCCAGGGAAGG + Intergenic
961716575 3:128861655-128861677 AGGGAAGCCGGGCCCCTGGCTGG - Intergenic
961724894 3:128921306-128921328 AGGAAAGCTGAGCACTCGGAAGG + Intronic
961751114 3:129095438-129095460 AGGGGAGAGGGGCACACGGAGGG - Intronic
961805119 3:129483733-129483755 AGGGAAGCTGGGCCCTTTGCTGG + Intronic
961893200 3:130147267-130147289 AGGGAAGGGGGGCCCCGGGAAGG - Intergenic
962320020 3:134382421-134382443 AGGGCAGCTGTGCCCTCAGAAGG - Intergenic
965659851 3:171029600-171029622 AGTGTGGCTGGGCCCACGGAAGG - Intergenic
966721279 3:183064691-183064713 ATGGCTGCTGGGCCCACGGCAGG + Intronic
968632043 4:1656833-1656855 AGGTAAGCAGGGCCAACAGAGGG + Intronic
968657562 4:1785272-1785294 AGGGGAGCTGGGCGGGCGGAAGG + Intergenic
969463105 4:7339195-7339217 AGAGTAGCTGTGCACACGGAGGG - Intronic
969595727 4:8148374-8148396 AGTGAAGCAGGGCCCACAGGAGG + Intronic
969817910 4:9699681-9699703 AGGGCAGCTCAGCCCAGGGAGGG + Intergenic
975779069 4:77819957-77819979 AAGGAAGCTGCGCCCCCGCAGGG + Intergenic
979727789 4:123985083-123985105 AGGGAAGCAGGGCCCACAGCGGG + Intergenic
985070954 4:186166237-186166259 AGGGAACCTGGCCCCAGGTAGGG - Intronic
985606726 5:861945-861967 AGAGAAGCTGAGCTCAGGGAAGG + Intronic
985806529 5:2048411-2048433 AGGGAAGCTGAGCATACGGGCGG + Intergenic
986600546 5:9468340-9468362 AGGGAAGCTGGTCCCACTCTGGG - Intronic
988104198 5:26722578-26722600 AAGGATGCTGGGCCCATTGAAGG - Intergenic
990699545 5:58460312-58460334 GGGACAGCGGGGCCCACGGACGG - Intergenic
991660343 5:68944828-68944850 AGGGAATCTGAGCCCAGAGATGG - Intergenic
993375977 5:87149751-87149773 ACGGAAGTGGGGCCCACAGAAGG + Intergenic
996082895 5:119274736-119274758 AGGGAAGCTCTGCCCAGGTAGGG + Intronic
997418180 5:133745235-133745257 AGGGAAGCTGGGTCCATAGAAGG - Intergenic
998116713 5:139543421-139543443 AGGGAAGCTGGGCCCACGGAAGG - Intronic
998229396 5:140350419-140350441 AGGGAAGCTGTGCCCCCTGGGGG + Intergenic
999174454 5:149622046-149622068 AGGGAAGCATGGCCCAGGTAAGG + Exonic
999663971 5:153893867-153893889 GGGGTGGCTGGGCCGACGGAGGG - Intergenic
1001686196 5:173596696-173596718 AGTGAGGCTGAGCCCACGGCAGG - Intergenic
1002041812 5:176520275-176520297 AGGGCACCTGGGCCCAGGGGTGG + Intergenic
1002322669 5:178384928-178384950 AGGGAGGCTGGGCACAGGGAAGG - Intronic
1002800182 6:514871-514893 AGGGAGGCAGGGCCCTCTGAGGG + Intronic
1002887976 6:1312629-1312651 AGAGAAGCTGGTGCCAGGGAAGG - Exonic
1006804711 6:36780491-36780513 AGGGAAACTGAGCACACAGAGGG - Intronic
1007340091 6:41185945-41185967 AGGGGAGCAGGGCCAAGGGAGGG - Intergenic
1008088237 6:47266844-47266866 AGGGAAGCTGTGCAGAGGGAAGG - Intronic
1011268400 6:85550623-85550645 AGAGTAGCTGGGCCCACAGGCGG + Intronic
1014103429 6:117536989-117537011 AGGAAACTTAGGCCCACGGAAGG - Intronic
1014979829 6:127932756-127932778 AATGAAACTGGGCCCAAGGAGGG - Intergenic
1015395094 6:132724861-132724883 AGGGTAGGTGGGCTCACGGCGGG + Exonic
1015450368 6:133360683-133360705 AGGGGAGCTGGGCACATAGAGGG + Intronic
1015612409 6:135038531-135038553 AGGGATGCTGGGCACACAGATGG - Intronic
1016350741 6:143164492-143164514 TGAGAAGCTGGGTCCATGGAGGG - Intronic
1016872197 6:148829365-148829387 AGGGAAGTTGGGCCTAGAGAGGG - Intronic
1017043292 6:150324844-150324866 AGGGAAGCTAGGCCCACAGTCGG - Intergenic
1017758091 6:157546621-157546643 AGGGAAGCTGGGGTCACTGGAGG + Intronic
1017808459 6:157966774-157966796 ATGGGAGCTGGGCCAACAGACGG - Intergenic
1018150683 6:160934647-160934669 AGGGAAGCTTGGCACACTGTTGG - Intergenic
1018631587 6:165826825-165826847 AGGGGTGCTGGGGACACGGAGGG + Intronic
1018631879 6:165828739-165828761 AGGGAAGCAGAGCCCACTGCGGG + Intronic
1018790720 6:167145627-167145649 AGGGCAGCTGGGGCCCCAGAGGG + Intergenic
1018854540 6:167666234-167666256 AGGGTAGCTGGCCTCATGGAGGG + Intergenic
1019267558 7:127004-127026 GTGGGAGCTGGGCCCAGGGAGGG - Intergenic
1019367844 7:644491-644513 AGGGATGCTGGACCCCGGGATGG - Intronic
1021574333 7:22093909-22093931 AGGGCAGCTGGCCCCTGGGAAGG - Intergenic
1023221243 7:37921382-37921404 AGGGGCGCTGCGCCCACCGAGGG + Intronic
1029147948 7:98459724-98459746 TAGGGAGCTGGGACCACGGAGGG + Intergenic
1029794126 7:102875835-102875857 AGGGAAGCTGGAACCACAGCAGG + Intronic
1032394792 7:131581619-131581641 AGGTGAGCTGGGCCCGGGGACGG - Intergenic
1032541280 7:132705157-132705179 AGGGAATCAGGGCCAACGGAAGG - Intronic
1033164674 7:139029671-139029693 AGGGAAGCAGGGTCTAAGGAAGG - Intronic
1034263817 7:149772287-149772309 AGGGAGGCGGGGGCCTCGGAGGG - Intronic
1035353938 7:158265908-158265930 AGAGAAGCTGGGCAAACAGATGG - Intronic
1035700017 8:1631287-1631309 AGGGCAGCTGGGCCCTGGGTCGG + Intronic
1036748750 8:11429706-11429728 AGGCGAGCTGGGCCCAGGGGTGG + Intronic
1039408570 8:37333129-37333151 AGGAAAGCCAGGCCCATGGAGGG + Intergenic
1041241896 8:55855245-55855267 AGGGAAGGTGTGCCCAGGGAGGG - Intergenic
1044119112 8:88372523-88372545 AGGGAAGCTAGGCACACTGCTGG - Intergenic
1044622496 8:94204005-94204027 AGGGAAGATGGGCTCACGGGAGG + Intronic
1045467890 8:102486437-102486459 AGGGAACCAGGGCTCAGGGAAGG - Intergenic
1049201632 8:141343370-141343392 AAGGAGGCTGAGCCCAGGGATGG + Intergenic
1050905063 9:10993681-10993703 AGGGAACCTGGGCCCAGACAAGG - Intergenic
1053201022 9:36151668-36151690 AGGGAACATGGACCCACAGAAGG - Intronic
1053350657 9:37411418-37411440 AGGGAAGTGGGGCCCACTGAAGG + Intergenic
1056270171 9:84939844-84939866 AGGGAAGCAGAGCCAAGGGATGG - Intronic
1057176593 9:93004736-93004758 AGGGAAGCCGGGCCTGCGAAGGG - Intronic
1060300361 9:122371347-122371369 GGGGAAGCTGGGCCCGCTGGAGG - Intronic
1061504574 9:131024674-131024696 AGGGAAGAACGGCCCACGCAGGG - Intronic
1061749883 9:132770306-132770328 AGGGAAGCTGAGCGCGCCGAGGG - Intronic
1061907209 9:133704844-133704866 GGGGAGGCGGGGCACACGGAGGG + Intronic
1061924770 9:133800554-133800576 AGGTGAGCTGGGCCCAGTGATGG + Intronic
1061936910 9:133862968-133862990 AGGGAAGCTGGGGTCATGGAAGG + Intronic
1061957370 9:133970599-133970621 AGCAAGGCTGGGCCCAGGGAAGG - Intronic
1062024277 9:134333107-134333129 AGGGATGCTGAGACCATGGAGGG + Intronic
1062033740 9:134373558-134373580 AAGGAAGGTAGGCCCAGGGAGGG - Intronic
1062303229 9:135887586-135887608 AGGGATGCAGGGCCCAGGTAGGG + Intronic
1062458832 9:136654357-136654379 AGGGAAGCCAGGGCCAGGGAAGG + Intergenic
1189374973 X:40459671-40459693 AGGCCAGCTGGGCCCAAGGCAGG - Intergenic
1192174789 X:68878950-68878972 AGGAAACCAGGGCCCAGGGAAGG - Intergenic
1192555117 X:72083032-72083054 GGGGAAGCTGGGACCACAGAAGG - Intergenic
1195035064 X:100965045-100965067 AGGGCAGCAGGGCCCTGGGATGG - Intergenic
1195967250 X:110439818-110439840 AGGAAAGCAGGGCCTAGGGAAGG - Intronic
1199988892 X:152972790-152972812 AGTGATGCTGGGCCCACAGATGG - Exonic