ID: 998116714

View in Genome Browser
Species Human (GRCh38)
Location 5:139543425-139543447
Sequence ATAGAGGGAAGCTGGGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 327}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116714_998116724 13 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116714_998116725 14 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116714_998116727 27 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116714_998116722 10 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116722 5:139543458-139543480 ATCCTGGATTGCACGTCAGTAGG No data
998116714_998116719 -6 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116719 5:139543442-139543464 CTCTATACCCACGTAGATCCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
998116714_998116728 28 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116714_998116726 23 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116714 Original CRISPR ATAGAGGGAAGCTGGGCCCA CGG (reversed) Intronic
900477150 1:2881434-2881456 ATGGAGGCAGGCTGGGCCCAGGG - Intergenic
900654476 1:3748308-3748330 ATAGAAAGCAGCTGGCCCCAGGG + Intergenic
900808626 1:4784517-4784539 TTAGAGGGAGACTGAGCCCAAGG - Exonic
901744382 1:11362911-11362933 AGAGAGACAAGCTGGGCCCTGGG + Intergenic
902891930 1:19450672-19450694 AAAAAGAGAAGCTGGGCACAAGG + Intronic
904833683 1:33321274-33321296 TTTGGGGGAAGCTGGCCCCAAGG + Intergenic
904871978 1:33624820-33624842 GGAGAGAGGAGCTGGGCCCAGGG - Intronic
905709641 1:40090305-40090327 ATGGAGGATAGCTGGGCACATGG - Intronic
905835647 1:41117960-41117982 ATAAAAGACAGCTGGGCCCAGGG - Intronic
906662141 1:47590581-47590603 AGAGAGGGAGGCTGGGGTCAGGG + Intergenic
908500397 1:64737875-64737897 ATCATGGGAAGCTGGGGCCAAGG + Intergenic
911427659 1:97740926-97740948 AGAGAGGGAAGCTGGGAGGAAGG - Intronic
911780325 1:101868787-101868809 ATAGAGGGAACCTTGTCCCAAGG - Intronic
912472772 1:109916993-109917015 ATATAGGGAAGGTGGGCTCCAGG - Intronic
912801018 1:112719802-112719824 AGAGTGGGAAGCTCAGCCCAGGG + Intergenic
913960590 1:143335767-143335789 GGAGAGGGCAGCTGGGCCCTGGG + Intergenic
914054944 1:144161339-144161361 GGAGAGGGCAGCTGGGCCCTGGG + Intergenic
914124202 1:144805022-144805044 GGAGAGGGCAGCTGGGCCCTGGG - Intergenic
915471810 1:156130197-156130219 AGGGAGGGAAGCTTGGCCAAAGG + Intronic
915544144 1:156586383-156586405 GCAGAGGGAAGCTGAGGCCAAGG + Intronic
915895345 1:159807584-159807606 AGAGATGGAGGCTGGGCCTAAGG + Intronic
920186833 1:204164853-204164875 GTAGAAGGAAGCTGGGCACGCGG - Intronic
920263250 1:204703876-204703898 ACAGAGGGAAACTGAGCCCGGGG - Intergenic
920569891 1:207008618-207008640 CCAGAAGGAAGCTGGGCACAGGG + Intronic
922057416 1:222054736-222054758 ATAGAGGGAGGCTGAGCCTGAGG + Intergenic
923114010 1:230917353-230917375 AGAGTGGGAATGTGGGCCCAAGG + Intronic
1064584156 10:16822939-16822961 ATGCAGGGAAGCAGGGCCCTGGG - Intergenic
1065245039 10:23748150-23748172 AGTGAGGGAGGCTGGGCCAAGGG - Intronic
1067029020 10:42868023-42868045 GGAGAGGGCAGCTGGGCCCTGGG + Intergenic
1067060526 10:43075990-43076012 AGCCAGGGAACCTGGGCCCAGGG - Intergenic
1067118804 10:43456464-43456486 AGAGAGGTGAGCTGGGCCTAAGG + Intronic
1068648991 10:59500772-59500794 ATACAGGGAAGCTGGGTGAAAGG - Intergenic
1069078751 10:64065808-64065830 AGAGAAAGCAGCTGGGCCCAGGG + Intergenic
1069380075 10:67834227-67834249 ATAAAGGGAAGCTGGGTTAAGGG + Intronic
1069546507 10:69333164-69333186 ATAGAGGGAGGCAGTGCCCATGG + Intronic
1069677729 10:70260473-70260495 GGAGAGGGCAGCTGGGCCCAGGG + Intronic
1070605888 10:77898369-77898391 ACAGAGGGGAGCTGGGGACAAGG + Intronic
1070811088 10:79298477-79298499 ATGGAGGGATGCTGCTCCCAGGG - Exonic
1071415539 10:85437607-85437629 ATGGAGAGAAGCTGGGCAGAAGG - Intergenic
1071995918 10:91149241-91149263 ATTTGGGGAAGCTGGGCTCAGGG + Intergenic
1072629972 10:97139089-97139111 GGAGAGGGAAGCAGAGCCCAGGG + Intronic
1073782767 10:106857373-106857395 ATAGAGGGAAGCTTGGGCACAGG + Intronic
1075150719 10:119927868-119927890 ACATAGGGTAGCTGGGCCAAAGG + Intronic
1076075442 10:127530351-127530373 ACAGGGGGAAGCTGGGACCAGGG + Intergenic
1076732338 10:132445009-132445031 CTAGAGCCCAGCTGGGCCCAGGG + Intronic
1076825213 10:132963731-132963753 GGAGAGGGAAGATGTGCCCAAGG + Intergenic
1076848386 10:133081120-133081142 ATACAGGGAAGCTGGAGCCTCGG + Intronic
1077052604 11:574503-574525 ATAAAGAGCAGCTGGGCCCCGGG - Intergenic
1077163216 11:1122922-1122944 AGAGAGGGAGGGTGGGTCCACGG - Intergenic
1077227450 11:1444631-1444653 AGGGAGGGAAGCTGGAGCCAGGG - Intronic
1077532723 11:3104705-3104727 ATCGTGGGACCCTGGGCCCAGGG + Intronic
1077536065 11:3124863-3124885 CTAGTGGGAAGCTGGGCAGAGGG - Intronic
1080332230 11:31152950-31152972 ATAGATGGCAGCTGGGCCACTGG - Intronic
1082008959 11:47437813-47437835 AGGGAGGGGAGCTGGGCCCAGGG + Exonic
1083333537 11:61910258-61910280 ATAAAGCGCTGCTGGGCCCAGGG + Intronic
1083392977 11:62368581-62368603 ATAGAAGAAAAGTGGGCCCAGGG + Intronic
1083492645 11:63024119-63024141 ATAGAGGGAAGCTGGCCGCCAGG - Intergenic
1083643733 11:64159936-64159958 CTAGAGGGAGAATGGGCCCATGG + Intronic
1084123195 11:67081629-67081651 CCAGAGGGCAGCAGGGCCCAAGG + Intergenic
1084283341 11:68114407-68114429 ACACAGGGAGGCTGGGCACAGGG + Intronic
1084317124 11:68351987-68352009 ATGTAGGGAAACAGGGCCCAAGG + Intronic
1084550625 11:69839650-69839672 ATAGAGGGAGGCTGAGCACGTGG + Intergenic
1084661793 11:70550454-70550476 ATAGTGAGAAGCAGGGTCCAGGG - Intronic
1085029807 11:73264298-73264320 AAAGAGGGAAACTGAGGCCAGGG + Intergenic
1085402604 11:76243592-76243614 AGAGAGGGAAGAGGTGCCCAGGG + Intergenic
1085519237 11:77128468-77128490 AGAGTGGGCAGCTGGGCCCCAGG + Exonic
1085527672 11:77173645-77173667 ACAGGGGGAAGCTGGGGCCTCGG + Intronic
1085757764 11:79215847-79215869 AGAGAGGGCTGCAGGGCCCACGG - Exonic
1087025370 11:93644230-93644252 AGAGAGGAAAGATAGGCCCAGGG + Intergenic
1088483639 11:110320335-110320357 GAAGAAGAAAGCTGGGCCCAGGG - Intergenic
1089785300 11:120903257-120903279 ACAGAGGAGAGCTGGGCTCAGGG - Intronic
1090288030 11:125517175-125517197 AAGGAGGGCAGCTGGACCCAAGG - Intergenic
1091184562 11:133636113-133636135 GCAGAGTGAAGCTGGGGCCACGG - Intergenic
1091692820 12:2608731-2608753 GCGGAGGGAAGCGGGGCCCACGG + Intronic
1092444223 12:8538583-8538605 AGAAAAGGCAGCTGGGCCCAAGG - Intronic
1092916518 12:13194440-13194462 AAAGAGAGACGCTGGGCTCAGGG - Intergenic
1093079668 12:14794995-14795017 ATAGAGGGTGGCTGGGCACCAGG + Exonic
1094818442 12:34207701-34207723 ATAGAGGGAAGGAGGGACAAAGG - Intergenic
1096220313 12:49824928-49824950 ATAGCAGAAAGCTGGGCCCTTGG - Intronic
1096770675 12:53934203-53934225 CTTGAGGGAAGATGGGACCAGGG - Intergenic
1097971231 12:65635198-65635220 AAAGAGAGAAGTTGGGACCAAGG + Intergenic
1098852213 12:75610430-75610452 CTAGAAGAAAGCTGGGCACAGGG + Intergenic
1100581301 12:95942865-95942887 GTAGGGGAAAGCTGTGCCCAGGG - Exonic
1101652555 12:106690740-106690762 ATGGACGGGAGCTGGTCCCACGG + Intronic
1101875719 12:108595923-108595945 GCAGAGGGCAGCTGGGACCATGG + Intronic
1103026687 12:117579909-117579931 ATCGAGGGGAGATGTGCCCAGGG - Intronic
1104415712 12:128595462-128595484 AAGGGGGGAAGCTGGGCCCAGGG + Intronic
1104476581 12:129075349-129075371 ATAAAAGGAAGATGGGCCCTTGG + Intronic
1104511203 12:129380437-129380459 ATTGAGAGAAGCTGGGCAAAGGG - Intronic
1104812840 12:131628851-131628873 ATAGAGGGAGGCCGGGCTGAAGG - Intergenic
1105280254 13:18959083-18959105 ATACAGGGCAACGGGGCCCAGGG + Intergenic
1105307846 13:19181605-19181627 AGAGAAGGATGCGGGGCCCAGGG - Intronic
1106030604 13:25998690-25998712 TTAGAGGAAAGTTGGGTCCAGGG + Intronic
1107291337 13:38857649-38857671 AGGGAGGGCAGCTGAGCCCAGGG - Intronic
1107376147 13:39806901-39806923 AGAGAGAGAAGGTGGGCCCCAGG - Intergenic
1108020496 13:46123165-46123187 ATGTAAGGAAGGTGGGCCCAGGG + Intergenic
1110456533 13:75695946-75695968 ATAGGGGAAAACTGGTCCCAAGG + Intronic
1113290891 13:108905125-108905147 ATACAGGGTAGCTGGGCACATGG + Intronic
1113767940 13:112892683-112892705 AAAGGGGGAGGCTGGGCTCAGGG - Intergenic
1114165723 14:20216572-20216594 AGAAAAGGCAGCTGGGCCCAGGG + Intergenic
1114267279 14:21080428-21080450 TGAGAGGGAAGCTGGGCTGATGG - Intronic
1116641813 14:47473080-47473102 ATAGAGGACACCTGGGCGCAAGG + Intronic
1118500976 14:66362329-66362351 ACAGAGGAAAGCTCTGCCCAGGG + Intergenic
1119304372 14:73595491-73595513 GTGAAGGGAAGCTGGGCACAGGG - Exonic
1120531599 14:85638660-85638682 AAAGTGTGAGGCTGGGCCCAAGG + Exonic
1121831280 14:97054444-97054466 ATAAAGAGGAACTGGGCCCAGGG + Intergenic
1123056387 14:105572557-105572579 AGCGAGGGAGGCTGGGCCCCGGG + Intergenic
1123057544 14:105579250-105579272 AGCGAGGGAGGCTGGGCCCCGGG - Intergenic
1123080822 14:105692685-105692707 AGCGAGGGAGGCTGGGCCCCGGG + Intergenic
1123081821 14:105699183-105699205 AGCGAGGGAGGCTGGGCCCCGGG - Intergenic
1123183467 14:106491457-106491479 ATAAAAGACAGCTGGGCCCAGGG + Intergenic
1125513158 15:40303527-40303549 ATAGAGAGAACCTGGGCCATAGG - Intronic
1125514381 15:40309528-40309550 ATCGAGGGAACCTGATCCCAGGG - Intergenic
1127217648 15:56841038-56841060 AGAGACAGAACCTGGGCCCAAGG + Intronic
1127875989 15:63111728-63111750 CCAGAGGGAAGCTGTGACCAGGG - Intergenic
1129921071 15:79319597-79319619 AAAGAAGACAGCTGGGCCCAGGG + Intronic
1130512445 15:84600898-84600920 CAGGAGGGAGGCTGGGCCCAAGG - Intergenic
1131115225 15:89791225-89791247 ATAGAGGGAAGAAGGACCAAGGG - Intronic
1131146715 15:90018699-90018721 ACACAGGAAAGCTGGGCCCTGGG + Intronic
1134616840 16:15658090-15658112 ACAGAGGAAAGCTGGGCCAAGGG - Intronic
1136710325 16:32231716-32231738 AGAGAAAGCAGCTGGGCCCAGGG + Intergenic
1137249782 16:46732972-46732994 TGAAAGGGAAACTGGGCCCAGGG - Intronic
1137677250 16:50309804-50309826 CCAGAGGCCAGCTGGGCCCATGG - Intronic
1137754071 16:50887708-50887730 AAAGAAGGAAGCTGGGGCCGAGG + Intergenic
1138111921 16:54330718-54330740 AGAGAGGAAAGCAGGGCCCCGGG - Intergenic
1138299697 16:55915671-55915693 AGAGAGAGAAGGAGGGCCCAAGG - Intronic
1138545702 16:57718231-57718253 AGAGAAGGGACCTGGGCCCAGGG - Intronic
1138646101 16:58426189-58426211 ATAGAGGGTACCCGTGCCCAAGG + Intergenic
1138976594 16:62214830-62214852 ACAGAAGGAAGCTGGGCTGAAGG - Intergenic
1139487110 16:67264143-67264165 ATAAAGGGAAGCTTTTCCCAGGG + Intronic
1139960514 16:70714923-70714945 ACGGAGGGAAGTGGGGCCCAGGG - Intronic
1140495119 16:75379735-75379757 ATAGGGGGAAACTGGGTCAAAGG + Intronic
1140922614 16:79552936-79552958 ATAGCAGGAAGCTGTGACCAGGG + Intergenic
1141579332 16:84986526-84986548 GTAAAGGGATGCAGGGCCCAGGG + Intronic
1203059735 16_KI270728v1_random:958044-958066 AGAGAAAGCAGCTGGGCCCAGGG - Intergenic
1143743781 17:8974727-8974749 ATTTAGGGAAGCTGGGTCAAAGG + Intergenic
1144559614 17:16311156-16311178 AAAGAGGCAAGCTGTCCCCAAGG - Intronic
1145883761 17:28369193-28369215 GGACAGGGAAGCTGGACCCAGGG - Intronic
1146057864 17:29589911-29589933 ACCGGGGGACGCTGGGCCCACGG + Intronic
1146645030 17:34571573-34571595 ATGGAGAGAAGTTGGGCCCCCGG + Intergenic
1146951738 17:36911221-36911243 AAAGAGAGAAGCAGTGCCCAGGG + Intergenic
1147359675 17:39922927-39922949 ATGGAGGAAAGATGGGGCCAGGG + Intronic
1147567496 17:41546732-41546754 ACAGAGAGGAGCTGGGACCATGG + Intergenic
1147686024 17:42287442-42287464 GGAGAGGGAAGCTGGGCAAAGGG + Intergenic
1147950149 17:44102958-44102980 ATAAAGGGAACCTGGGCCGGGGG - Intronic
1148127038 17:45242274-45242296 CTGGAGGGAACCTGGGCCCAGGG - Intronic
1151400981 17:73855906-73855928 AGAGAGAGAGGCTGGTCCCACGG - Intergenic
1151527529 17:74681208-74681230 ATAGTGGGAAGCTGAGCCCTTGG + Intronic
1151786587 17:76278208-76278230 ACAGAGGGAGGGTTGGCCCATGG + Intronic
1151843384 17:76633764-76633786 ATAGAAGGCAGCTGGGCCTGGGG - Intronic
1152107829 17:78341482-78341504 AAAGAAGGAAGTGGGGCCCAGGG + Intergenic
1152426520 17:80221122-80221144 GCAGAGAGAAGCTGGGCCCGCGG - Intronic
1156471070 18:37377562-37377584 TGAGAGGGAAGCTGGGAACACGG + Intronic
1157909246 18:51599640-51599662 ATAGAGGCAAGCTGGAGCTAGGG - Intergenic
1158021221 18:52844350-52844372 ATAGATGTGAGCTGGGCCCTGGG + Intronic
1160191079 18:76714422-76714444 ATCGAGGGAACCTGGGTCCTGGG + Intergenic
1160417028 18:78718766-78718788 ATAGATCAAGGCTGGGCCCATGG + Intergenic
1160745167 19:708196-708218 AAACCAGGAAGCTGGGCCCAAGG + Intergenic
1160913823 19:1487525-1487547 CTGGCGGGGAGCTGGGCCCAAGG - Intronic
1161102365 19:2427474-2427496 GCAGCGGGAAGCTGGACCCAGGG - Exonic
1161376400 19:3941226-3941248 ATGGAGAGGGGCTGGGCCCAGGG - Intronic
1161575864 19:5053912-5053934 AAACAGGGAAGCTGGGCACCAGG - Intronic
1162430868 19:10627651-10627673 GCAGAGGGCAGATGGGCCCATGG + Intronic
1162918857 19:13888795-13888817 ATGGAGAGAAGCTGGGCCTGGGG - Intronic
1164502424 19:28831256-28831278 GTCAAGGGGAGCTGGGCCCAGGG + Intergenic
1164617519 19:29675816-29675838 GGAGAGGGAAACTGGGCCCCAGG + Intergenic
1164823000 19:31264521-31264543 ATAGGGAGGAGCAGGGCCCAGGG + Intergenic
1165070954 19:33254557-33254579 GTAGAGAGAGGCTGGGCTCAGGG + Intergenic
1165329220 19:35132045-35132067 GTGGAGGGAAGCTGGGGTCAGGG + Intronic
1165533429 19:36422625-36422647 GTGAAGGGAAGCTGGGCACAGGG - Intergenic
1165860251 19:38905591-38905613 AATCAGGGAAGCTGAGCCCAGGG - Intronic
1166775216 19:45308193-45308215 ATAGGGTGGAGCTGGGTCCAGGG + Intronic
1167016261 19:46842910-46842932 ATAGAGGGAAACCGAGGCCAAGG - Intronic
1167526826 19:49989425-49989447 ATAGTGGGAGGCTGGGCACTGGG - Intronic
1168058542 19:53877404-53877426 AGAGAAAGCAGCTGGGCCCAGGG + Intergenic
1168627405 19:57930313-57930335 GGAGAAGGAAGCTGTGCCCATGG + Intronic
1202694426 1_KI270712v1_random:114014-114036 GGAGAGGGCAGCTGGGCCCTGGG + Intergenic
925644426 2:6021336-6021358 GCAGAGGGTAGCTGAGCCCAGGG - Intergenic
925783599 2:7406631-7406653 ATCTAAGGAAGCTGGGACCAAGG - Intergenic
926111838 2:10188672-10188694 ATAAAGGGCAGCTGGGACCCAGG + Intronic
928083082 2:28327152-28327174 AGAGAAAGAAGCTGGTCCCATGG + Intronic
931085290 2:58823319-58823341 AGAGAAAGCAGCTGGGCCCAGGG - Intergenic
932441937 2:71743093-71743115 AGAGAAGGGAGCCGGGCCCAGGG + Intergenic
932478687 2:72025036-72025058 AGAGAGGGGAGAAGGGCCCACGG - Intergenic
932602101 2:73134725-73134747 AGGGAGGCAAGCAGGGCCCAGGG + Intronic
933952135 2:87340550-87340572 GGAGAGGGCAGCTGGGCCCTGGG - Intergenic
934236379 2:90236888-90236910 GGAGAGGGCAGCTGGGCCCTGGG - Intergenic
935881912 2:107573634-107573656 AGAAAAGGCAGCTGGGCCCAGGG - Intergenic
936025208 2:109026493-109026515 TCAGAGGGAAGAGGGGCCCAAGG - Intergenic
936388296 2:112050025-112050047 AGAAAAGGCAGCTGGGCCCAGGG - Intergenic
936728508 2:115353214-115353236 CTAGAGGGCAGATGAGCCCAGGG + Intronic
937097304 2:119243733-119243755 AAAGATGGAAGCTGGGGCCCAGG + Intronic
938765790 2:134459843-134459865 ATTGAGGGGAGCAGGGCTCATGG - Intronic
939345668 2:140963942-140963964 AGAAAAGGCAGCTGGGCCCAGGG + Intronic
940616442 2:156054628-156054650 CTCCAGGGAAACTGGGCCCAGGG - Intergenic
941324361 2:164094755-164094777 ATTGAAGGAAGCTGGGCGAAGGG - Intergenic
941928270 2:170916851-170916873 AGAAAAGGCAGCTGGGCCCAGGG - Intergenic
942833780 2:180267674-180267696 ATGGAGGGAAGCTGGGGGGAGGG - Intergenic
946195773 2:218032476-218032498 AAAGAGAGATGCTGGGCCTACGG + Intergenic
948156702 2:235788944-235788966 CTAGAGGGCAGCAGGGGCCAGGG - Intronic
948280959 2:236747716-236747738 ACAGAGGGAGGCTGGGCACTTGG + Intergenic
1168953904 20:1820947-1820969 AGATGGGGAAGCTGGGCCCAAGG - Intergenic
1169140124 20:3223093-3223115 ATTAAGGGAAGCTGGGGACAGGG - Intronic
1169168825 20:3447502-3447524 AGAGAAAGGAGCTGGGCCCAGGG + Intergenic
1169189801 20:3651350-3651372 CTACAGGGCAGCTGGGCCCGTGG + Intergenic
1169203938 20:3729832-3729854 ATGGAGGGGACCTGGGGCCAGGG + Intergenic
1171817962 20:29805276-29805298 ATAGAGAAAAAGTGGGCCCAGGG - Intergenic
1171900275 20:30850004-30850026 ATAGAGAAAAAGTGGGCCCAGGG + Intergenic
1172600533 20:36179745-36179767 ACAGCGGGCAGCTGGGCCCAGGG + Intronic
1173302539 20:41816900-41816922 CTAGAGGGAAGATGTGCACAGGG - Intergenic
1173720130 20:45251136-45251158 AGAGAAAGCAGCTGGGCCCAGGG + Intergenic
1174120042 20:48258179-48258201 AGAGAGAGAAGATGGGGCCAGGG - Intergenic
1175724151 20:61305874-61305896 CTAGAGTGAAGATCGGCCCACGG + Intronic
1175799916 20:61795728-61795750 AAGGAGGGAGGCTGGGCCCCAGG + Intronic
1176032178 20:63017890-63017912 AGAGAGGGAACCTGGGCTCAGGG - Intergenic
1176117031 20:63437249-63437271 TTCGAGGGAAGCAGGGCGCATGG + Intronic
1176260720 20:64178082-64178104 GAAGAGAGAAGCTGGGACCAAGG - Intronic
1179454781 21:41491554-41491576 ATGGAGGCAAGCTGGGGCCAAGG + Intronic
1179970303 21:44833200-44833222 AGAGAAAGCAGCTGGGCCCAGGG - Intergenic
1180321408 22:11324758-11324780 ATAGAGAAAAAGTGGGCCCAGGG - Intergenic
1180333640 22:11555995-11556017 ATAGAGAAAAAGTGGGCCCAGGG + Intergenic
1182989377 22:34752303-34752325 AGAGAGGTAAGCAGGGCCCAGGG - Intergenic
1183064409 22:35353361-35353383 AGAGAGGGAAGCAGGACCCCGGG + Intergenic
1183340692 22:37279407-37279429 AGAGCAGGAAGCTGGACCCAGGG - Intergenic
1184136249 22:42551623-42551645 ATAAAAGACAGCTGGGCCCAGGG + Intergenic
1184352254 22:43952090-43952112 GTGGAGGGCAGATGGGCCCAAGG - Intronic
1184587963 22:45460542-45460564 AGGGATGGAAGCTGGGCCCGGGG - Intergenic
1184942872 22:47781862-47781884 ACACAGGGAAGCTGGGGTCACGG + Intergenic
1184980497 22:48092071-48092093 AGAAAGGGAGGCTTGGCCCAAGG - Intergenic
1185080599 22:48707558-48707580 ACACAGGGACACTGGGCCCAGGG - Intronic
1185358048 22:50386850-50386872 ATAGAGGTCAGCTGGGTACATGG - Intronic
953127132 3:40102169-40102191 ATAGAGGGACTCTGAGACCAGGG - Intronic
954370325 3:50166706-50166728 AGAGATGGGGGCTGGGCCCAGGG + Intronic
954689300 3:52387284-52387306 AGACAGGGAAGCTGGGCCCCAGG - Intronic
956906029 3:73766307-73766329 AGAAAGGGAAGCTGGCACCAAGG - Intergenic
958904486 3:99927031-99927053 ATGGAGTGAAGATGGGGCCAAGG - Intronic
961191719 3:124967977-124967999 ATAGAGAGGAGCCGGGCGCAGGG - Exonic
961406617 3:126684216-126684238 AAAAAGGGAAACTGGGGCCAAGG + Intergenic
961718213 3:128873354-128873376 AGAGAGCGAAGCAGGGCTCAGGG - Intergenic
962575985 3:136755486-136755508 GTAGAGGGAAGGTGGGTCAATGG - Intergenic
966422674 3:179748862-179748884 AGATAGGGAAGCTGGGCTTATGG - Intronic
967374851 3:188789355-188789377 AATCAGGAAAGCTGGGCCCAGGG + Intronic
968050909 3:195654395-195654417 AGAAAGGGCAGCTGGGCCCGGGG - Intergenic
968104916 3:195993943-195993965 AGAAAGGGCAGCTGGGCCCGGGG + Intergenic
968566952 4:1318100-1318122 ATTGGGGGAAGCCGGGCACACGG - Intronic
969602299 4:8183425-8183447 GTAGAGGGAGGCGTGGCCCAGGG + Intronic
971338733 4:25748352-25748374 GTATTGGGAAGCTGGGGCCAGGG - Exonic
973803643 4:54502743-54502765 ATGGAGGCAAGCTGGGCCTGTGG - Intergenic
975377757 4:73665549-73665571 AGAAAAGGCAGCTGGGCCCAGGG + Intergenic
975842398 4:78488812-78488834 AGACAGGGAAGCTGTGGCCATGG - Intronic
976213111 4:82691789-82691811 CTAAAGGGAAGCTGGGGCCATGG + Intronic
978679810 4:111366521-111366543 ATAGAGGGCAACTGAGCCCATGG - Intergenic
980478005 4:133345067-133345089 GTAGAGGGAAGGAGGGTCCAGGG + Intergenic
981552364 4:145954948-145954970 AAGGAGGGAATCTGTGCCCAGGG + Intergenic
982202520 4:152974364-152974386 AAAGCTGGAAGTTGGGCCCAAGG + Intronic
983266525 4:165513515-165513537 AGGGAGGGAAGCTGCACCCAAGG + Intergenic
986652581 5:9979369-9979391 AGAGAGGGAGCCTGGGACCAGGG - Intergenic
988948777 5:36236576-36236598 CTAGAAGGAAGCTGGTCCCCAGG + Intronic
991640504 5:68747044-68747066 TTAGAGCGAAGCTGGGGGCAGGG - Intergenic
992810714 5:80385632-80385654 ATAGTGAGAAGCTGGGGTCAGGG + Intergenic
994024803 5:95070232-95070254 TGAGAGGCAAGCTGGGCTCAGGG - Intronic
995458491 5:112377338-112377360 ATTGAGGGAAACTGGGCAAAGGG + Intronic
997308757 5:132861940-132861962 ATTGAAGGAAGCTGGGCCCAAGG + Exonic
998116714 5:139543425-139543447 ATAGAGGGAAGCTGGGCCCACGG - Intronic
999325115 5:150639015-150639037 AGAGAGGCAAGCTGAGCCCCAGG - Intronic
1000056328 5:157609826-157609848 CTAGAGGGAATCTGGGTCAAAGG - Intergenic
1000571820 5:162924199-162924221 GTGGAGGGAAGGAGGGCCCAGGG + Intergenic
1001150796 5:169225768-169225790 AGAGAGGGAGGCAGGGGCCAGGG + Intronic
1002205837 5:177562023-177562045 ATAAAAGACAGCTGGGCCCAGGG - Intergenic
1002360580 5:178667577-178667599 AATGAGGAAAGCTGGGCCCCAGG + Intergenic
1002409834 5:179065126-179065148 ATAACGGGAAGCTGGGTGCAGGG - Intronic
1002637162 5:180614188-180614210 ACAGAGGGAAGCTTGTCCCGTGG + Intronic
1003119014 6:3304891-3304913 GGAGAGGGATGCAGGGCCCAGGG + Intronic
1004522430 6:16374715-16374737 ATAGAGCGAAGCTGGGGCCTGGG + Intronic
1005576445 6:27194334-27194356 ATAAAAGACAGCTGGGCCCAGGG + Intergenic
1005996119 6:30932394-30932416 GGAGAGGGAAGCGGGGACCAGGG + Intergenic
1006132953 6:31879696-31879718 CTAGAGGGAATGTGGGTCCAAGG - Intergenic
1006455995 6:34132248-34132270 ACAGAGGGAAGCTTGGTTCAGGG + Intronic
1006905646 6:37531663-37531685 AGAGAGGGAAGCTGGGGCACAGG + Intergenic
1007321843 6:41033366-41033388 AGAGAGGGAAAGTGGGCTCAGGG + Intronic
1007716510 6:43859142-43859164 AAAGTGGGAATCTGGGGCCATGG + Intergenic
1007717838 6:43867532-43867554 ATAGTGGGATGTTGGCCCCAGGG + Intergenic
1008662301 6:53680869-53680891 AGAGAAGGAAGCTGGGCTGAGGG - Intergenic
1009320529 6:62282877-62282899 AGACAAGGAAACTGGGCCCAGGG + Intronic
1012541370 6:100366004-100366026 ATATAGGGAACCTGGCTCCAGGG + Intergenic
1017595469 6:156023784-156023806 ATAGAGGGAGGCTGGGTGAAGGG + Intergenic
1017886806 6:158606515-158606537 AAAGAGGGAAGATGGTCCCTAGG + Intronic
1017926237 6:158913844-158913866 AAAGAAGGGAGCTGGCCCCAAGG - Intergenic
1019334527 7:476715-476737 AAAGGGGGAACCTGGACCCAGGG + Intergenic
1019489074 7:1302767-1302789 ATTGTGGGATGCTGGGCCCAGGG + Intergenic
1019629983 7:2043824-2043846 ATAGACATAAGCTGGGCCCAGGG + Intronic
1019738653 7:2662349-2662371 AGAGAGTGAAGCTGGGGCAACGG - Exonic
1022711347 7:32853887-32853909 GTAGAGAGAGGCTGGGCCAACGG + Intergenic
1023567521 7:41538367-41538389 CTAGAGGGAAGCAGGGCCTTTGG + Intergenic
1024160013 7:46664290-46664312 ATAGATGGAAACTGGGACCTGGG - Intergenic
1024339565 7:48243430-48243452 CTAGAGTGAAGCTGGACACATGG - Intronic
1024456597 7:49615318-49615340 AGAGAAAGCAGCTGGGCCCAGGG - Intergenic
1024534418 7:50418325-50418347 AGAGGGAGAAGCTGAGCCCAGGG + Intergenic
1025976801 7:66376811-66376833 GGAGACGGGAGCTGGGCCCACGG + Intronic
1026905373 7:74060091-74060113 AGAGATGGAGGCGGGGCCCATGG - Intronic
1027237231 7:76305257-76305279 AGAGAGGGGAACTGGGCCCTTGG - Intergenic
1027512168 7:79096390-79096412 ATAGAAGGAAGCTGTACACAAGG - Intronic
1029438753 7:100576153-100576175 GTGGAGGGAGGCTGGTCCCAAGG + Intronic
1029467287 7:100734216-100734238 TTTCAGGTAAGCTGGGCCCAGGG + Exonic
1029699621 7:102237733-102237755 ATAAAAGGCAGCTGGGCCCGGGG + Intronic
1032484616 7:132276028-132276050 ATAGAGAGAAACTGGGACTAAGG - Intronic
1032962348 7:137051021-137051043 ATAGAGTGAAGCTGGGGACATGG - Intergenic
1033164675 7:139029675-139029697 AGAGAGGGAAGCAGGGTCTAAGG - Intronic
1033643813 7:143286237-143286259 AGAGAGGGAGGATGGGCCCAAGG - Intronic
1033785733 7:144727613-144727635 AGAAAAGGCAGCTGGGCCCAGGG - Intronic
1034338651 7:150338919-150338941 ATGGATGGAAGCTGAGCCTATGG - Intronic
1034433718 7:151053330-151053352 AGAGAGGGAAGTTGGGCCTGTGG - Intergenic
1035700016 8:1631283-1631305 AGCGAGGGCAGCTGGGCCCTGGG + Intronic
1035993983 8:4525162-4525184 ATAGAGGGAAGGTGGGAGCCTGG - Intronic
1036692871 8:10955896-10955918 TGAGAGGGAAGCTGTGGCCATGG + Intronic
1036748748 8:11429702-11429724 TCAGAGGCGAGCTGGGCCCAGGG + Intronic
1037385683 8:18338124-18338146 ATAAAGGGAAGGAGGGCCCAGGG - Intergenic
1040143147 8:43951128-43951150 ATAGAGGGATTCTGGGCCCATGG + Intergenic
1040271850 8:45958356-45958378 ATAGAGGGATTCTGGGCCCATGG + Intergenic
1042164660 8:65933874-65933896 ATGGGGGGAAGATTGGCCCAAGG + Intergenic
1042595612 8:70444608-70444630 ATTGAGGGAAACTGGGCAAAGGG + Intergenic
1043928104 8:86060903-86060925 ATACAGGAAAGAGGGGCCCAGGG - Intronic
1045276609 8:100711846-100711868 ATAGGGGGACTCTTGGCCCACGG + Intronic
1046067020 8:109209623-109209645 CTAGAGGGAAACTGGACCAATGG + Intergenic
1046803210 8:118451601-118451623 AGAGAGGGCTGATGGGCCCAAGG + Intronic
1047529194 8:125659806-125659828 ATAGAGTGCAGCTGGGCTTAAGG - Intergenic
1047643291 8:126843796-126843818 ACAGATGGAAGCAGGGACCAGGG - Intergenic
1055123630 9:72692493-72692515 ATGGAGGGAAGGCGGGTCCAGGG + Intronic
1056270172 9:84939848-84939870 ACAGAGGGAAGCAGAGCCAAGGG - Intronic
1056442362 9:86633730-86633752 ATGGAGGGATACTGGGCACATGG + Intergenic
1057143954 9:92746057-92746079 ATTGTGGGAAGTGGGGCCCAGGG - Intronic
1057698035 9:97341263-97341285 AGAAAAGGCAGCTGGGCCCAGGG - Intronic
1058545414 9:106055924-106055946 ATAGAGCGATGCTGGGCCATGGG - Intergenic
1059153199 9:111967349-111967371 AAAGAGGGAAGTTAGGCCTATGG + Intergenic
1059385067 9:113958277-113958299 TTAGAGGCATGCTGGGTCCAGGG - Intronic
1059456257 9:114402186-114402208 GCAGAGGGAAGCTGGGGCCTTGG + Exonic
1059467466 9:114478020-114478042 ATGGAGGGAATCTGGGTCCCAGG + Intronic
1059655280 9:116352239-116352261 ATACAGGGGTGCTGGGCCCAGGG + Intronic
1060000404 9:119953304-119953326 AAATAGTGAAGCAGGGCCCAGGG - Intergenic
1060002980 9:119975352-119975374 ATGGTGGGAAGATGGGCCCTGGG - Intergenic
1061559990 9:131395672-131395694 ATAGAGCCAAACTGTGCCCATGG + Intronic
1061593354 9:131613175-131613197 ACAGAGGAAAGCGGGGCCCAGGG + Intronic
1061819535 9:133218580-133218602 ACAGAGGGAAACTGGCCCCCAGG + Intergenic
1061872999 9:133530552-133530574 AGAGAAGGAAGCTGAGGCCAAGG - Intergenic
1062201497 9:135305248-135305270 AAAGAGGGGAGATGGGCCCAAGG - Intergenic
1062241152 9:135539613-135539635 ACAGAGGGAAACTGGCCCCCAGG - Intergenic
1062478410 9:136740760-136740782 ATAGAGGGGCGCTGGGCACAGGG - Intronic
1203369627 Un_KI270442v1:290538-290560 ATAGAGAAAAAGTGGGCCCAGGG - Intergenic
1186843644 X:13509601-13509623 ATAGACTGTAGCTGGGCACAGGG - Intergenic
1187476158 X:19612935-19612957 AGAGAGGAAAGCTGTGCTCATGG + Intronic
1188543165 X:31271592-31271614 ATAGAGAGAAGCTGAACCCTAGG - Intronic
1189374974 X:40459675-40459697 GTGGAGGCCAGCTGGGCCCAAGG - Intergenic
1190595810 X:52052019-52052041 ATGGAGGGCAGCTGGGTCCCAGG + Exonic
1190613014 X:52202054-52202076 ATGGAGGGCAGCTGGGTCCCAGG - Exonic
1192191939 X:68996299-68996321 TCTGAGGCAAGCTGGGCCCATGG + Intergenic
1194093247 X:89603611-89603633 ATACAGGGTAGCAGGGCCCTGGG - Intergenic
1195520586 X:105823621-105823643 CTAGAGGGAAGCTGGGCATTCGG - Intronic
1198401927 X:136277159-136277181 ATTGGTGGAAGCTGGGCCAATGG - Intergenic
1200232043 X:154448985-154449007 CCTGAGGGAGGCTGGGCCCATGG - Intronic
1200395440 X:155983860-155983882 AGAGAGAGAAACTGGGTCCAGGG + Intergenic
1200445879 Y:3259714-3259736 ATACAGGGTAGCAGGGCCCTGGG - Intergenic