ID: 998116715

View in Genome Browser
Species Human (GRCh38)
Location 5:139543432-139543454
Sequence CGTGGGTATAGAGGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116715_998116724 6 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116715_998116727 20 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116715_998116725 7 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116715_998116722 3 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116722 5:139543458-139543480 ATCCTGGATTGCACGTCAGTAGG No data
998116715_998116728 21 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116715_998116726 16 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116715 Original CRISPR CGTGGGTATAGAGGGAAGCT GGG (reversed) Intronic
901234720 1:7661669-7661691 CGTGGGTGCAGAGGGGACCTGGG - Intronic
905961919 1:42050144-42050166 GATGGGAGTAGAGGGAAGCTGGG + Intergenic
906927044 1:50128831-50128853 AGTGGGTAAAGAAGGAAGATGGG + Intronic
906967422 1:50472104-50472126 CGTAGGTCTGGAGGGGAGCTGGG + Intronic
908775043 1:67631701-67631723 TGGGCGTGTAGAGGGAAGCTGGG + Intergenic
910366397 1:86469925-86469947 CATGCATATAAAGGGAAGCTGGG + Intronic
913267849 1:117062193-117062215 AGTGGGTAAAGATGAAAGCTAGG + Intronic
913486562 1:119337091-119337113 CTTGGGTGGGGAGGGAAGCTGGG - Intergenic
914730378 1:150364597-150364619 CGTAGGTGGGGAGGGAAGCTAGG - Intronic
919816386 1:201443414-201443436 GGTGTGGATAGAGAGAAGCTGGG + Intergenic
920877151 1:209847366-209847388 AGTGGGGATAGAGAGAAGATGGG - Intronic
1063005691 10:1968487-1968509 TGGCGGTACAGAGGGAAGCTTGG + Intergenic
1063123297 10:3119848-3119870 TGTGGGGCGAGAGGGAAGCTGGG - Intronic
1063866518 10:10371007-10371029 ACTGGGGTTAGAGGGAAGCTAGG + Intergenic
1064162345 10:12957300-12957322 CTTCGGTATAGAGCTAAGCTCGG - Intronic
1065213460 10:23426827-23426849 CTTGGGAATAAAGGGAAGATTGG - Intergenic
1065407841 10:25389025-25389047 AGTGGGTGCTGAGGGAAGCTTGG + Intronic
1065478791 10:26171366-26171388 TGTGGGGAAAGAAGGAAGCTAGG - Intronic
1067796880 10:49327224-49327246 TGTGGGTACAGAGGGACACTTGG - Exonic
1068830249 10:61485816-61485838 TGAGGGCATAGAGGGATGCTGGG - Intergenic
1071044688 10:81359631-81359653 AGAGGGTATAGCAGGAAGCTAGG + Intergenic
1072898010 10:99383704-99383726 ACTGGGTAGAGAGAGAAGCTGGG + Intronic
1073425628 10:103453909-103453931 AGTGGGAATAGAGGGAAGGATGG + Exonic
1073595143 10:104792117-104792139 CATAAGTATAGAGGGAAGCCTGG + Intronic
1073782765 10:106857366-106857388 TCAGGCTATAGAGGGAAGCTTGG + Intronic
1074203024 10:111256695-111256717 CGTGGGGATTCAGGGAAGCCAGG + Intergenic
1075399660 10:122151770-122151792 CGTGGGGATGGAGGGGACCTGGG + Intronic
1078532885 11:12150637-12150659 GGAGGATATAGAGGGATGCTGGG - Intronic
1081107605 11:39090372-39090394 GGTGAGTATATAAGGAAGCTAGG - Intergenic
1083041054 11:59687902-59687924 CGTGGGGTTGGAGGGAAGGTGGG + Intergenic
1083309139 11:61775600-61775622 CGTGGGTATGGAGAGGATCTGGG + Intronic
1088744218 11:112792006-112792028 CCTAGGTATTGAGGGAAGCTAGG - Intergenic
1089400026 11:118159054-118159076 CAGGGGTATAGAGGGGACCTGGG + Intergenic
1091038585 11:132255854-132255876 CCTGGGTGTAGAGGTGAGCTTGG - Intronic
1091564136 12:1635605-1635627 GGTGGCTATGGAGGGTAGCTCGG + Intronic
1093993613 12:25617483-25617505 CGTGGTAATAGAGGGAAGGCAGG + Intronic
1095960008 12:47828611-47828633 CTAGGGTATACAGGGTAGCTTGG + Intronic
1097881900 12:64694071-64694093 CTTGGGCAGAGAGTGAAGCTCGG + Intronic
1099682287 12:85844197-85844219 AGTGGGGACTGAGGGAAGCTCGG + Intergenic
1103040671 12:117692880-117692902 CATGGGGATAGGGGGAAGCTAGG + Intronic
1107715949 13:43199609-43199631 CGGGGGCTTGGAGGGAAGCTTGG + Intergenic
1108179770 13:47829230-47829252 CCTGGGAATGGAGGTAAGCTGGG - Intergenic
1108783864 13:53870755-53870777 AGTGGGGATAGAGAGAAGATTGG - Intergenic
1109785385 13:67167907-67167929 CTGGGGTATAGAGGGAAACATGG - Intronic
1117486792 14:56205547-56205569 CGTGGGGTTAAGGGGAAGCTTGG + Intronic
1121071830 14:91030279-91030301 ACTGGGTATAGAGAGAAGCAAGG + Intronic
1121169172 14:91838439-91838461 CTTAGGTATCAAGGGAAGCTGGG - Intronic
1128998136 15:72311915-72311937 CTTGGGTAGAGAGGGCAGATGGG - Intronic
1129238032 15:74235344-74235366 TGGGGGTAGAGAGGGAGGCTGGG + Intergenic
1131533863 15:93217411-93217433 CCTGGGTCCTGAGGGAAGCTGGG + Intergenic
1132937642 16:2489595-2489617 ACTGGGTATGGAGGGCAGCTTGG + Intronic
1135135257 16:19882600-19882622 CATGGGGATAGAGAGACGCTGGG - Intronic
1137483386 16:48871100-48871122 GGTTGGTATAGAGGGAGGGTTGG + Intergenic
1140496090 16:75390190-75390212 AAAGGGTATAGAGGGAATCTAGG - Intronic
1144443777 17:15307895-15307917 CGGGGGTAGGGAGGGAATCTTGG + Intronic
1144557416 17:16294465-16294487 CTTGGTTATAGAGGGCAGCGGGG - Intronic
1145835570 17:27952126-27952148 CGTGGGATGAGAGGGAAGCAGGG + Intergenic
1146678012 17:34786546-34786568 AGTGAGTATAGAGGGAAGGGAGG + Intergenic
1147964858 17:44189136-44189158 CGTAGGTAGAGAGCCAAGCTAGG - Exonic
1152279387 17:79376364-79376386 TGTGGGTGGAGAGGGAAGGTGGG + Intronic
1152747696 17:82048899-82048921 CGTGGGTACAGGGAGAAGCCGGG + Intronic
1153328169 18:3843121-3843143 TGTGTGTATATAGGGAAGGTGGG + Intronic
1158256895 18:55561204-55561226 CATTGGAGTAGAGGGAAGCTAGG - Intronic
1162376598 19:10308904-10308926 CGGGGGTACAGAGTGAGGCTCGG - Exonic
1163489154 19:17606759-17606781 CGTGGGTCTAGAGGAGAGCCTGG - Intronic
1166194313 19:41196085-41196107 CGAGGGTAAAGAGGGAATCAGGG + Intronic
1168020783 19:53607200-53607222 TGTGGGAATAGGGGGAATCTGGG - Intergenic
930002145 2:46868775-46868797 CATGGGTCTAAAGGGAAGATAGG - Intergenic
931713313 2:65008277-65008299 GGTGGGTATAGCTGAAAGCTGGG - Intronic
936617775 2:114066077-114066099 GGAGGGTATAGAGGGAAGGAAGG - Intergenic
942921776 2:181382962-181382984 CATGGGTATGGAGGGAAGGTAGG + Intergenic
946554102 2:220835819-220835841 CATGGGTACAGTGGGAGGCTGGG - Intergenic
948798529 2:240419527-240419549 CGTGGGTGTGGAGAGGAGCTGGG - Intergenic
1171188265 20:23138907-23138929 CCTGGGTAAGGAGGGAAGCCGGG + Intergenic
1171907567 20:30912377-30912399 CGTGGGTAGTGAGGGGAGCTGGG - Intergenic
1173300645 20:41799365-41799387 GCTGAGTATGGAGGGAAGCTGGG + Intergenic
1175422479 20:58843234-58843256 AGGGTGTAAAGAGGGAAGCTGGG - Intronic
1179170703 21:38970732-38970754 CGTGGGAAGAGAGGGCAGGTGGG - Intergenic
1179454941 21:41492923-41492945 CGTGGGGATGGAAGGAAGCCAGG - Intronic
1180024102 21:45148835-45148857 CATGGGTGGAGAGAGAAGCTGGG - Intronic
1181182379 22:21077361-21077383 CGTGGGGATAGAGGGAAACCTGG - Intergenic
1183346669 22:37311974-37311996 GGTGGGAAGAGAGGGAGGCTGGG - Intronic
1184832785 22:47000290-47000312 CTTGGGGATGGAGGGAAGCCTGG + Intronic
1184976456 22:48065886-48065908 AGGGAATATAGAGGGAAGCTGGG + Intergenic
950473507 3:13201228-13201250 GGTGGGTACAGAGGGAAGGTTGG - Intergenic
952598470 3:35048511-35048533 CTGGGGTTTTGAGGGAAGCTGGG - Intergenic
956894139 3:73642212-73642234 CTTGGGGATGGAGGGAACCTTGG + Intergenic
961789948 3:129368470-129368492 GGTGGGTACACAGGGAAGGTCGG + Intergenic
961890861 3:130129389-130129411 ACTGGGTTAAGAGGGAAGCTAGG + Intergenic
961999940 3:131285283-131285305 AGTGGGTAGAGAGAGAAGGTGGG + Intronic
962240941 3:133750426-133750448 CGCGGGGATTGAGGGAAGCCAGG - Intronic
969500924 4:7552487-7552509 CGTCAGTTTAGAGGGAACCTGGG - Intronic
970229478 4:13893947-13893969 CCAGGGTTTAGAGGGAACCTTGG - Intergenic
974787765 4:66642807-66642829 TGTGGGTATAGAGGGCATTTAGG - Intergenic
989669451 5:43897832-43897854 TGTGGGAATAGAGGAAATCTTGG + Intergenic
992714188 5:79493351-79493373 CTTGGGAATAGAGGGAAGAATGG - Intronic
992810711 5:80385625-80385647 CCTGGCTATAGTGAGAAGCTGGG + Intergenic
997503556 5:134397701-134397723 CTTGGGCTTAGAGGGAAACTAGG + Intergenic
998116715 5:139543432-139543454 CGTGGGTATAGAGGGAAGCTGGG - Intronic
998532944 5:142902157-142902179 CTTGGGTTCAGAGGGAAACTAGG + Intronic
1002665946 5:180825200-180825222 CTTGGGGATAAAGGGAAGTTTGG - Intergenic
1003860670 6:10319390-10319412 CGTGGGGATAGAGGGACGTGGGG + Intergenic
1006822947 6:36913150-36913172 CATGGTAACAGAGGGAAGCTGGG + Intronic
1010656551 6:78518317-78518339 CCAGGGTATAGAGGGAATCTGGG + Intergenic
1010754503 6:79651800-79651822 CGTGGGTATAAATGGGAGTTTGG + Intronic
1011352216 6:86435197-86435219 CGTGGGGTTAGAGAGGAGCTGGG - Intergenic
1012601453 6:101102589-101102611 GGTGGGAACAGAGTGAAGCTGGG - Intergenic
1016594392 6:145783038-145783060 CATGTGGATAGAGGGAAGCCAGG - Intergenic
1023709288 7:42974749-42974771 CGTGGGCACAGAGGGAGGTTGGG + Intergenic
1028428104 7:90713554-90713576 TGTGGGGAGAGAGGGAAGATGGG + Intronic
1031214599 7:118873950-118873972 AGTGGGGCTAGAGGGAAGGTGGG - Intergenic
1032023182 7:128421443-128421465 CCTGGGGATGGAGGGAGGCTTGG - Intergenic
1037659784 8:20916617-20916639 AGTGGGTATGGGGGGAAACTGGG + Intergenic
1037666778 8:20976554-20976576 AGTGGGTAGGGAGGGAGGCTAGG - Intergenic
1039086971 8:33789627-33789649 TGTGGGGAAAGATGGAAGCTGGG + Intergenic
1043115487 8:76248130-76248152 GGCAGGCATAGAGGGAAGCTGGG - Intergenic
1044251429 8:90007441-90007463 GGTGGATATAGAGGGACACTGGG + Intronic
1044852149 8:96439470-96439492 AGTGGGAATGGAGGGAAGCAAGG + Intergenic
1046788935 8:118299545-118299567 GGGGGGAATAGAGGGAAGCAAGG + Intronic
1048480858 8:134791348-134791370 CCTGACTATACAGGGAAGCTGGG - Intergenic
1048492387 8:134906198-134906220 AGTGGGGAAAGAGGGATGCTGGG - Intergenic
1050254427 9:3779335-3779357 TGTGGGTCTGGAGGGAAGCCTGG - Intergenic
1051029650 9:12658693-12658715 CGGGGGTGTTGAGGGCAGCTTGG - Intergenic
1051357630 9:16254373-16254395 CCTGGGGAGAAAGGGAAGCTGGG - Intronic
1055085025 9:72305147-72305169 CGTGGGTAGATAAGGGAGCTCGG + Intergenic
1059456255 9:114402179-114402201 TGGGGGTGCAGAGGGAAGCTGGG + Exonic
1061193128 9:129093831-129093853 AGCGGGTAAAGAGGGAGGCTGGG - Intergenic
1061951414 9:133938397-133938419 CCTGGGTACAGAGGGACGCAGGG - Intronic
1186190455 X:7062691-7062713 GGTGGGTGGGGAGGGAAGCTGGG + Intronic
1199262417 X:145790701-145790723 CCAGGGAATACAGGGAAGCTTGG + Intergenic
1201297802 Y:12479583-12479605 CGTGGGCATGGGGGAAAGCTCGG - Intergenic