ID: 998116716

View in Genome Browser
Species Human (GRCh38)
Location 5:139543433-139543455
Sequence ACGTGGGTATAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116716_998116728 20 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116716_998116722 2 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116722 5:139543458-139543480 ATCCTGGATTGCACGTCAGTAGG No data
998116716_998116727 19 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116716_998116725 6 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116716_998116726 15 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data
998116716_998116724 5 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116716 Original CRISPR ACGTGGGTATAGAGGGAAGC TGG (reversed) Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
905494303 1:38372425-38372447 ACCTGGCTATAGTGGGTAGCTGG - Intergenic
912917386 1:113829099-113829121 ACATGGGAGTAGGGGGAAGCAGG - Intronic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG + Intergenic
921046963 1:211484748-211484770 AGGTGGGAAGAGAGGGAGGCAGG - Intronic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064896212 10:20240075-20240097 ACTTGAGGATAGAGGGAGGCAGG - Intronic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1069255487 10:66326691-66326713 ACGTGTGTATTGGGGGTAGCGGG + Intronic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1073935336 10:108624645-108624667 ATGTTGGTATAGAGGGGATCTGG - Intergenic
1075333423 10:121591838-121591860 ATGTGGGTATTGTTGGAAGCAGG - Intronic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1081296336 11:41394295-41394317 AGGAAGGTATAGAGAGAAGCTGG - Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083309138 11:61775599-61775621 ACGTGGGTATGGAGAGGATCTGG + Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1085232088 11:74981012-74981034 ACTTGGGCATAGAGGGATTCAGG + Intergenic
1085828377 11:79872766-79872788 ACGTGAGAATGGAGGGAGGCAGG + Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1087813586 11:102634222-102634244 ACATAGAGATAGAGGGAAGCTGG - Intergenic
1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG + Intergenic
1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG + Intergenic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1102370023 12:112375084-112375106 ACCTGGGGATAGAGGCAGGCAGG - Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1106676795 13:31968387-31968409 ATCTGTGTATAGAGGGAAACTGG - Intergenic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113992913 14:16042478-16042500 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1131071707 15:89470300-89470322 ACGTCGGCAAAGATGGAAGCCGG - Intergenic
1132617009 16:846544-846566 ACGTGGGTTTACAGGAAACCGGG - Intergenic
1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG + Intronic
1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG + Intergenic
1136912282 16:34154230-34154252 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1138543325 16:57701600-57701622 AGGTGGGTATCGAAGGAAGGGGG + Intronic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1144557417 17:16294466-16294488 GCTTGGTTATAGAGGGCAGCGGG - Intronic
1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG + Intronic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG + Intronic
1154040242 18:10847577-10847599 ACGTGGGTGTAGTGGGGACCGGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1159103524 18:63980779-63980801 AAGAGGATATAGAGGGAAGGAGG - Intronic
1160459872 18:79030812-79030834 ACGAGTGTGTAGAGGGAGGCAGG + Intergenic
1161635037 19:5382927-5382949 AGGTGGGGAAAGTGGGAAGCGGG - Intergenic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166194312 19:41196084-41196106 ACGAGGGTAAAGAGGGAATCAGG + Intronic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1168705063 19:58465900-58465922 AGGTAGGTATAGAGGGAGGGAGG + Intergenic
926002954 2:9348895-9348917 ACGTGGGTATCCATGGAAGGCGG - Intronic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
936350100 2:111706152-111706174 ACTTGGGCTTAGAGGGAAGGTGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG + Intronic
945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG + Intergenic
946046425 2:216824992-216825014 AAGTGGTGATACAGGGAAGCAGG + Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
948617854 2:239212972-239212994 ACGTGGGTACAGAGGCTAGAGGG - Intronic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171907568 20:30912378-30912400 ACGTGGGTAGTGAGGGGAGCTGG - Intergenic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1176552752 21:8236149-8236171 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1176571650 21:8418552-8418574 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1176579562 21:8463115-8463137 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1180314357 22:11265041-11265063 ACGTGGGTAGTGGGGGGAGCCGG + Intergenic
1180341001 22:11618510-11618532 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1203257731 22_KI270733v1_random:152551-152573 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG + Intergenic
952598471 3:35048512-35048534 ACTGGGGTTTTGAGGGAAGCTGG - Intergenic
952998121 3:38904951-38904973 ACCTGGGTAGAGGTGGAAGCTGG - Intronic
956310364 3:67871866-67871888 AAGTGGGTATAGAATGTAGCTGG + Intergenic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
968463547 4:737898-737920 ACGTTGGCATAGCGGGTAGCTGG + Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
970016734 4:11520465-11520487 ACCTTGCTAGAGAGGGAAGCAGG - Intergenic
971013760 4:22466367-22466389 ACGTGGGTGAAGAGGGATGGAGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG + Intergenic
981900636 4:149857898-149857920 ATGGTGGTATAGAGGCAAGCTGG + Intergenic
984930950 4:184846690-184846712 ACGTGGGATTAGTGGGAACCAGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
988638700 5:33016985-33017007 GCGTTGTTATAGAGGGATGCAGG + Intergenic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990980024 5:61593910-61593932 AGGTGGGTATAGAAGGATGGTGG - Intergenic
995973604 5:118003914-118003936 ACGAGGTTAAAGATGGAAGCAGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1010656549 6:78518316-78518338 TCCAGGGTATAGAGGGAATCTGG + Intergenic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1017064601 6:150517745-150517767 ACTTGGTGATAGAGGGAAGGGGG - Intergenic
1019721231 7:2572838-2572860 ACGTGGATAAAGAGAGAGGCCGG - Intronic
1021559459 7:21955469-21955491 ATGTGGCTATAGAGGGCAACAGG - Intergenic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1028105023 7:86867185-86867207 TCGTGGGTAGAGGGAGAAGCAGG - Intergenic
1028143970 7:87301125-87301147 ACTTGAGTGTAGAGGGAAGGAGG + Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1037927270 8:22853567-22853589 AGGTAGGAATAGAGGGAACCAGG + Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1046801761 8:118436383-118436405 AGGTTGGTGTAGAGGGCAGCAGG + Intronic
1049265179 8:141664087-141664109 AAGTGGGTATAGACTGAGGCTGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051384558 9:16493942-16493964 ACGAGGGTAGAGAGGCAGGCAGG + Intronic
1052609388 9:30752273-30752295 AAGTGGGTATACAGTAAAGCTGG - Intergenic
1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG + Intergenic
1057343373 9:94224356-94224378 ACGAGGGGAAAGAGGGAAGGAGG - Intergenic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061489660 9:130938243-130938265 ACGCGGGTGCAGAGGGAGGCGGG - Intronic
1061951416 9:133938398-133938420 GCCTGGGTACAGAGGGACGCAGG - Intronic
1062257608 9:135635821-135635843 ACGTGGGAATGGATTGAAGCTGG - Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1203473923 Un_GL000220v1:134573-134595 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1203362663 Un_KI270442v1:231162-231184 ACGTGGGTAGTGGGGGGAGCCGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1190123047 X:47679306-47679328 AATTGGGTATAGAGGGATGAGGG + Intergenic
1191942480 X:66496361-66496383 ACATGGGTATAGAGAGTAGAAGG - Intergenic
1195364217 X:104112163-104112185 ACCTTTGTATAGGGGGAAGCGGG - Intronic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic