ID: 998116717

View in Genome Browser
Species Human (GRCh38)
Location 5:139543440-139543462
Sequence AGGATCTACGTGGGTATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116717_998116730 28 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116717_998116725 -1 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116717_998116727 12 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116717_998116726 8 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data
998116717_998116729 24 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116717_998116722 -5 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116722 5:139543458-139543480 ATCCTGGATTGCACGTCAGTAGG No data
998116717_998116728 13 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116717_998116724 -2 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116717 Original CRISPR AGGATCTACGTGGGTATAGA GGG (reversed) Intronic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
906445175 1:45890058-45890080 AGGAACTAGATTGGTATAGATGG - Intronic
922550281 1:226489528-226489550 AGGATCTACCTGGGTGTGCAGGG - Intergenic
1063724129 10:8618062-8618084 TGGTTATACGTGGGTATAAAAGG - Intergenic
1070415293 10:76183631-76183653 AAGATCCATGTGGGTACAGAAGG + Intronic
1076599243 10:131646442-131646464 AGGACCAACGTGGGTGCAGACGG - Intergenic
1081519460 11:43867691-43867713 TGGATATTCCTGGGTATAGACGG - Intergenic
1085223227 11:74894249-74894271 AGGATCTACTTGAGGGTAGAGGG + Intronic
1087940319 11:104088844-104088866 AGAACCTCCCTGGGTATAGAGGG - Intronic
1088142833 11:106637962-106637984 AGGATATATGTGTGTATATATGG + Intergenic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1094114042 12:26890864-26890886 AGGATCTAAGTGGAAATAGTCGG - Intergenic
1094128258 12:27046334-27046356 AGGAGTTACCTGGGGATAGAAGG - Intronic
1098039564 12:66340524-66340546 AGGATATATGTGGATATAAAAGG + Exonic
1102498828 12:113337393-113337415 AGGCTCTAAGTGTTTATAGAAGG - Intronic
1104341158 12:127950233-127950255 AGGATGTAGGTGGATATTGACGG + Intergenic
1107798906 13:44084825-44084847 AGGATGCAAGTGGGTAGAGAAGG - Intergenic
1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG + Intergenic
1119285712 14:73452566-73452588 AGGGTTTTCGTGGGTAGAGAGGG + Intronic
1121386695 14:93533758-93533780 AGGATCTTTGTGGTTATTGAAGG + Intronic
1126047173 15:44653005-44653027 AGTATGTATGTGGGTATAGGTGG + Intronic
1135921965 16:26658686-26658708 AGGATGCACGTGGCTATAGAGGG - Intergenic
1145943694 17:28758112-28758134 GGGATCTAAGTGGGGACAGAAGG - Exonic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1162256481 19:9494256-9494278 AGAATCAAAGTGTGTATAGATGG + Intronic
1168722482 19:58561823-58561845 AGGAACCACGTGGTTACAGAGGG + Intergenic
926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG + Intronic
927381965 2:22489597-22489619 AGGATCTACTTGAGGGTAGAGGG + Intergenic
927906493 2:26862446-26862468 ATGATCTACTTGGGTCTATAGGG + Intronic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
930458538 2:51638823-51638845 AGGATGTACCTGGGATTAGAAGG + Intergenic
931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG + Intergenic
936776313 2:115977730-115977752 CGGATCCAGGTGGATATAGATGG + Intergenic
942927987 2:181456837-181456859 AGGAAGGAAGTGGGTATAGAAGG + Intergenic
1170804219 20:19616004-19616026 AGGATCTATGTACCTATAGAAGG - Intronic
1176063816 20:63183848-63183870 AGGACCTCCATGGGTAGAGAGGG + Intergenic
1182176804 22:28298535-28298557 AGGATTTACTTGAGTCTAGAAGG - Intronic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
950481720 3:13248224-13248246 AGCATCTACGTGGGTTCAGGAGG + Intergenic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
974046928 4:56906538-56906560 AGGTCCTACGTGGGTATACCAGG + Intergenic
979539833 4:121869413-121869435 AGGATCTAAGGGGTTAGAGAAGG - Intronic
980611027 4:135164022-135164044 AGGATCTACATAAATATAGAAGG - Intergenic
988868760 5:35364659-35364681 AGTGACTACGTGGGTTTAGAAGG + Intergenic
990527513 5:56642631-56642653 AGGCTCTACGTGAGTACAGAGGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
1001288262 5:170439027-170439049 AGGATCTAAGTTGATAGAGAGGG - Intronic
1001799541 5:174530964-174530986 TGGATATAGGTGGGTATATATGG + Intergenic
1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG + Intergenic
1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG + Intronic
1008847292 6:55983425-55983447 AGGATGGGCGTGGGTAGAGAGGG - Intergenic
1012710077 6:102588326-102588348 AGTATGTACGTGTGTATACATGG + Intergenic
1013296346 6:108761397-108761419 AGCATCTAAGTGGGTACAGAGGG - Intergenic
1025580962 7:62716696-62716718 AGAATCTACGTAGGGATATATGG + Intergenic
1029923729 7:104294155-104294177 AGGATCTACCTTGGGATGGACGG - Intergenic
1030663266 7:112246076-112246098 AGGAACTACATTGGTATAAAAGG + Intronic
1036383398 8:8255205-8255227 AGGTTTTATGGGGGTATAGAAGG - Intergenic
1048668716 8:136693432-136693454 AGGATGTACTTGAGGATAGAGGG - Intergenic
1050494945 9:6230731-6230753 AGGATCTATGAGGATATAGTGGG - Intronic
1050764738 9:9118273-9118295 AGGATCTACCTGAGAATACATGG + Intronic
1057560215 9:96122306-96122328 AGGATCTTCAGGGGTAAAGAGGG - Intergenic
1058120475 9:101133146-101133168 TGGATCAAAGTGGGTATTGATGG - Intronic
1059599136 9:115757268-115757290 AAGATCTATGTGGGTATAAATGG + Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1191783748 X:64895422-64895444 AGGATCTAGGTGGGAATATATGG - Intergenic
1194521445 X:94922993-94923015 AGGATATACGTACATATAGAAGG - Intergenic
1195285034 X:103376091-103376113 AGGGGCTACGTGGGCATTGATGG + Intergenic
1195672051 X:107477966-107477988 AGGATCTAGGTGGGTCTTGAAGG - Intergenic