ID: 998116718

View in Genome Browser
Species Human (GRCh38)
Location 5:139543441-139543463
Sequence CAGGATCTACGTGGGTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116718_998116729 23 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116718_998116726 7 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data
998116718_998116725 -2 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116718_998116722 -6 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116722 5:139543458-139543480 ATCCTGGATTGCACGTCAGTAGG No data
998116718_998116730 27 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116718_998116728 12 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116718_998116727 11 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116718_998116724 -3 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116718 Original CRISPR CAGGATCTACGTGGGTATAG AGG (reversed) Intronic
911498005 1:98654137-98654159 CACGAACTAAGTGGCTATAGTGG - Intergenic
911598351 1:99822234-99822256 CAGGATCTGTGTGGGGGTAGTGG - Intergenic
913562673 1:120038292-120038314 AAGAATGTACATGGGTATAGAGG - Intronic
913635449 1:120755313-120755335 AAGAATGTACATGGGTATAGAGG + Intergenic
914283270 1:146197672-146197694 AAGAATGTACATGGGTATAGAGG - Intronic
914544300 1:148648392-148648414 AAGAATGTACATGGGTATAGAGG - Intronic
914622332 1:149422618-149422640 AAGAATGTACATGGGTATAGAGG + Intergenic
915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG + Intronic
1064874194 10:19974725-19974747 TAGGTTCTCCATGGGTATAGTGG - Intronic
1072337618 10:94412928-94412950 CAGGATCTACTTGGGTCTCAAGG - Intronic
1077836269 11:5930346-5930368 CCGGATCTAGGCGGGTATAGTGG - Intronic
1079183579 11:18215546-18215568 CAGGTTCCAGGTGGGTCTAGAGG - Intronic
1082659636 11:55894638-55894660 TAGGGTGTACGTGGGTACAGTGG + Intergenic
1085223226 11:74894248-74894270 CAGGATCTACTTGAGGGTAGAGG + Intronic
1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG + Intergenic
1092144570 12:6205575-6205597 CAGGATCTATGTGTGTAAGGGGG - Intronic
1093046926 12:14457435-14457457 CAGGATCAAACTGGGTATGGTGG + Intronic
1100133470 12:91524511-91524533 CAGTGTGTAAGTGGGTATAGTGG + Intergenic
1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG + Intronic
1119285711 14:73452565-73452587 CAGGGTTTTCGTGGGTAGAGAGG + Intronic
1135921966 16:26658687-26658709 AAGGATGCACGTGGCTATAGAGG - Intergenic
1143439398 17:6957447-6957469 CAGGTTCTGCGGGGGTTTAGTGG - Intronic
1151085481 17:71375677-71375699 CAGGATATACGTAGATATACAGG + Intergenic
1156486796 18:37471544-37471566 CAGGATCTAGGTGGATGGAGGGG - Intronic
1160072777 18:75643038-75643060 CAGAAGCCACGTGGGTAGAGGGG + Intergenic
1168382168 19:55933159-55933181 CAGGTTCTATGGGGGAATAGTGG - Intergenic
1168722481 19:58561822-58561844 CAGGAACCACGTGGTTACAGAGG + Intergenic
925787934 2:7451361-7451383 CATATTCTAAGTGGGTATAGTGG - Intergenic
927381964 2:22489596-22489618 CAGGATCTACTTGAGGGTAGAGG + Intergenic
935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG + Intergenic
935791112 2:106591123-106591145 CAGCATCTACTTGGGTTTTGGGG + Intergenic
940033749 2:149291765-149291787 CAGGACCTACCTGCGTAGAGGGG + Intergenic
944502358 2:200375205-200375227 CTGGAGTTACGTGGGTATATAGG + Intronic
1173455767 20:43200008-43200030 CAGGGTCTATCTGGGTATGGGGG - Intergenic
1176063815 20:63183847-63183869 CAGGACCTCCATGGGTAGAGAGG + Intergenic
951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG + Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956809999 3:72855613-72855635 CAGGATCTGGCTGGGTACAGTGG + Intronic
961054523 3:123776887-123776909 CAGGATCTACAGGGGCATAGTGG - Intronic
962921342 3:139953246-139953268 GAGGATCTGTGTGGGCATAGAGG - Intronic
964257334 3:154791112-154791134 CAGGATTTCCATGGATATAGAGG - Intergenic
967241500 3:187444220-187444242 CAGAACCTAAGTGGGAATAGAGG - Intergenic
971048547 4:22832748-22832770 CTGGTTCTATGTGGGCATAGTGG - Intergenic
978551756 4:109935023-109935045 TAGGATTTTCTTGGGTATAGGGG + Intronic
984765991 4:183400863-183400885 CAGAATCTACATGGTTAGAGGGG - Intergenic
990527514 5:56642632-56642654 AAGGCTCTACGTGAGTACAGAGG - Intergenic
991187765 5:63830457-63830479 CAGGAGTTAGGTGGGTACAGGGG + Intergenic
991187871 5:63831743-63831765 CAGGAGTTAGGTGGGTACAGGGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998148158 5:139742129-139742151 CAGGGTATATGTGGGTATGGGGG + Intergenic
1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG + Intergenic
1006085134 6:31589839-31589861 CAGCATCTACGTGTGCAGAGTGG - Exonic
1013296347 6:108761398-108761420 CAGCATCTAAGTGGGTACAGAGG - Intergenic
1023315910 7:38936190-38936212 CAGGATCTAGCTGGGTGCAGTGG - Intergenic
1023734746 7:43224873-43224895 CAGGAGGGACGTGGGTGTAGTGG + Intronic
1024447988 7:49503965-49503987 CAGCAGCTCTGTGGGTATAGTGG - Intergenic
1027404192 7:77842354-77842376 CAAGATCTAGCTGGGCATAGTGG - Intronic
1028590479 7:92488160-92488182 CAGGATGTATGTGGATAAAGGGG + Intronic
1038520514 8:28228274-28228296 CAGGAGATACCTGGGTATTGAGG + Intergenic
1040467273 8:47706600-47706622 AAGGATCGACGTGGCTATAAAGG - Intronic
1048098131 8:131316516-131316538 CAGTATGTACGGGGGTAAAGAGG - Intergenic
1048668717 8:136693433-136693455 CAGGATGTACTTGAGGATAGAGG - Intergenic
1050494946 9:6230732-6230754 GAGGATCTATGAGGATATAGTGG - Intronic
1055167538 9:73215493-73215515 CAGGCTCCACGTGGGGAGAGAGG + Intergenic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1061689835 9:132318186-132318208 CAGGAGCTAGTTGGGGATAGAGG - Intronic
1186436053 X:9544013-9544035 CAGGATCTAAGTGGGGGCAGGGG - Intronic
1187354756 X:18557459-18557481 CAGTATCTACGAGGATATAGAGG - Intronic
1189010567 X:37042724-37042746 CAGGATCTGCGGGGGTGGAGGGG - Intergenic
1189012797 X:37063330-37063352 CAGGATCTACTGGGGTGGAGGGG - Intergenic
1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG + Intronic
1190919489 X:54838883-54838905 CAGGCCCTAGGTGGGTCTAGAGG + Intergenic
1197744583 X:129923209-129923231 CAGGATCAACTTGGGAATGGAGG + Intronic