ID: 998116720

View in Genome Browser
Species Human (GRCh38)
Location 5:139543449-139543471
Sequence GTGCAATCCAGGATCTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116720_998116729 15 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116720_998116726 -1 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data
998116720_998116725 -10 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116720_998116727 3 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116720_998116728 4 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116720_998116731 25 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
998116720_998116730 19 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116720 Original CRISPR GTGCAATCCAGGATCTACGT GGG (reversed) Intronic
902560007 1:17271346-17271368 GTTGAATCCAGGATCAGCGTGGG - Intronic
902567839 1:17325084-17325106 GAGAAATCCAGGAACTAAGTTGG - Intronic
907569558 1:55470357-55470379 GAGCACTCCAGGATCTCCTTGGG + Intergenic
923437188 1:233978570-233978592 CTGCAATCCAGGATCCCTGTGGG + Intronic
1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG + Intronic
1096073927 12:48790098-48790120 TTTCACTCCAGGATGTACGTAGG + Intergenic
1097273693 12:57796224-57796246 GTGCCATCTGGGTTCTACGTTGG + Exonic
1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG + Intergenic
1108598048 13:51966698-51966720 GTGCAGAGCAGGGTCTACGTCGG - Intronic
1113405375 13:110033978-110034000 ATGCAATCCAGCATCTAAGTAGG + Intergenic
1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG + Intronic
1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG + Intronic
1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG + Intronic
1125700723 15:41680946-41680968 GTGCCATCCTGGATCTATTTAGG + Intronic
1125762224 15:42104391-42104413 TTGTAGTCCAGGATCTATGTGGG - Intergenic
1141700244 16:85639044-85639066 GTGCAACCCAGGATCAACTCAGG - Intronic
1158195672 18:54882600-54882622 GTGCTATCCAGGCTCAACGAAGG + Intronic
925222745 2:2155277-2155299 GTGCTATCCAGGAGCCACTTTGG - Intronic
925340542 2:3132568-3132590 GTGGAATCCAGGATCTGCCTGGG - Intergenic
935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG + Exonic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
946494265 2:220179802-220179824 GTGCATTCAAGGATCAATGTGGG + Intergenic
1175525880 20:59632997-59633019 GTGCACCCCAGGATCAAGGTGGG - Intronic
1185182025 22:49369147-49369169 GTGCTGTCCAGGAGCCACGTGGG - Intergenic
950481717 3:13248215-13248237 TGGAAATCCAGCATCTACGTGGG + Intergenic
956593851 3:70945450-70945472 GTGCAATGCATGATCCAGGTTGG + Intergenic
956868823 3:73396354-73396376 CTGCAAACCAGGACCTACCTCGG - Intronic
963359068 3:144247152-144247174 GTGTCATTCAGGATCTATGTGGG + Intergenic
968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG + Intronic
972737990 4:41864209-41864231 TTGCAGGCCAGGATCTACTTCGG + Intergenic
986149948 5:5119524-5119546 GTGGAATTCAGAATCTAAGTGGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG + Exonic
1006893124 6:37446886-37446908 GTGCCATCCAGGTTCTAAATAGG + Intronic
1024316084 7:48018086-48018108 GTGCAACCCAGTATCTTCTTGGG - Intronic
1030274783 7:107709115-107709137 GTGAAATCAGGGATCTACGCTGG - Intronic
1031608060 7:123793164-123793186 GTGCTATCCAGGATGTACAGAGG + Intergenic
1035316139 7:157998471-157998493 GTCCAACACAGCATCTACGTTGG - Intronic
1044209401 8:89532975-89532997 GTGCACTCCACGATTTACATGGG - Intergenic
1044869876 8:96608140-96608162 GTGCAAACCATGAACTACATGGG + Intronic