ID: 998116721

View in Genome Browser
Species Human (GRCh38)
Location 5:139543450-139543472
Sequence CGTGCAATCCAGGATCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116721_998116731 24 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
998116721_998116727 2 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116721_998116728 3 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116721_998116730 18 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116721_998116726 -2 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116726 5:139543471-139543493 CGTCAGTAGGCGGGCTGCAGAGG No data
998116721_998116729 14 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116721 Original CRISPR CGTGCAATCCAGGATCTACG TGG (reversed) Intronic
906546420 1:46622463-46622485 TGTGGAATCCAGACTCTACGGGG - Intergenic
1065126357 10:22577883-22577905 CGTTCAAGCCAGGATCCAGGCGG - Intronic
1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG + Intergenic
1076464012 10:130666130-130666152 AGTCCAATCCATGCTCTACGTGG - Intergenic
1093555698 12:20471026-20471048 CTTGAAATCCAAGATCTAGGTGG - Intronic
1094799313 12:34013520-34013542 CTTGCAATCAAGTGTCTACGTGG + Intergenic
1102047232 12:109837074-109837096 GGGGCAGTCCAGGAGCTACGTGG - Intergenic
1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG + Intronic
1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG + Intronic
1149951546 17:60993154-60993176 CGTGGAATACAAGATCTATGAGG - Intronic
1160708258 19:539850-539872 CGCGCACACCAGGACCTACGAGG - Intronic
925340543 2:3132569-3132591 AGTGGAATCCAGGATCTGCCTGG - Intergenic
938840568 2:135158336-135158358 CGAGCAATCCAGGATGTTCCAGG - Intronic
948206081 2:236163565-236163587 GGGGCACTCCAGGATCTGCGGGG + Intergenic
1175525881 20:59632998-59633020 CGTGCACCCCAGGATCAAGGTGG - Intronic
1179132730 21:38653015-38653037 CGTGGAATCTAGAATCTAGGCGG - Intronic
1179376350 21:40853018-40853040 CGTGCATTGCAGGATCAAGGTGG - Intergenic
950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG + Intergenic
978947961 4:114521768-114521790 ACTGCTATCCAGGATCTATGAGG - Intergenic
985147036 4:186903875-186903897 CGTACAATCCAGTATCTATAAGG + Intergenic
985201010 4:187485624-187485646 CCTGTAATCCAGGAGCTACAAGG - Intergenic
990488074 5:56278612-56278634 CGTGCATTCCAGGGTCTTGGAGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1000622911 5:163505624-163505646 CCTCCAACCCAGGATCGACGCGG - Exonic
1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG + Intergenic
1007201055 6:40109473-40109495 CATGCAATCCAGGAATTAAGAGG - Intergenic
1012703962 6:102497796-102497818 AGTACTATCCAGAATCTACGAGG - Intergenic
1035877201 8:3203906-3203928 TGTGCAATCCAGACACTACGGGG - Intronic
1042281154 8:67057736-67057758 AGTGCAATCCAGGTTTTATGAGG - Intronic
1044503117 8:92985373-92985395 GGTGGAATCCAGGAGCTAGGAGG - Intronic
1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG + Intergenic
1051235085 9:14991101-14991123 CCTGCAAACCAGGATCACCGAGG - Intergenic
1188562643 X:31486993-31487015 CAAGCAATCCAGGATGTACATGG + Intronic
1194290415 X:92064943-92064965 GGTGCACTCCAGGATCTGAGGGG + Intronic
1200607928 Y:5289542-5289564 GGTGCACTCCAGGATCTGAGGGG + Intronic