ID: 998116723

View in Genome Browser
Species Human (GRCh38)
Location 5:139543460-139543482
Sequence CGCCTACTGACGTGCAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116723_998116731 14 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
998116723_998116732 28 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116732 5:139543511-139543533 TGGTCCTGGCCTTACCCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 87
998116723_998116730 8 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116723_998116727 -8 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116723_998116729 4 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116723_998116728 -7 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116723 Original CRISPR CGCCTACTGACGTGCAATCC AGG (reversed) Intronic
902451593 1:16499750-16499772 TCCTGACTGACGTGCAATCCTGG + Intergenic
907552747 1:55318243-55318265 CGCCTTCAGACTTGCAGTCCTGG + Intergenic
1083814839 11:65126858-65126880 AGCCTTCTGACCTGCAATCAAGG + Exonic
1088461831 11:110091468-110091490 GGCCTACTGACGTGGAAAACAGG + Intergenic
1090474932 11:127011373-127011395 AGCCTACTGACAAGCAAGCCAGG - Intergenic
1090817265 11:130309638-130309660 GGCCTCCTGAAGTGTAATCCTGG - Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104225593 12:126829839-126829861 CTCATCCTGACGTGCAATCATGG + Intergenic
1110711176 13:78652816-78652838 CGCCTTCTGCTGTGCAGTCCTGG + Intronic
1118596005 14:67436237-67436259 CGCCTACTGGCCTGGCATCCTGG - Intergenic
1121777910 14:96602950-96602972 GGCCTCCTGACATGCAGTCCAGG + Intergenic
1123456125 15:20427672-20427694 CCCCTACTGACCTCCAAGCCAGG - Intergenic
1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG + Intergenic
940889264 2:159019152-159019174 AGACTGCTGACCTGCAATCCCGG - Intronic
943012710 2:182470616-182470638 CCACTACTGTCTTGCAATCCAGG + Intronic
945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG + Intergenic
946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG + Intronic
973955887 4:56062670-56062692 CTTCTGCTGACGTGGAATCCAGG + Intergenic
998116723 5:139543460-139543482 CGCCTACTGACGTGCAATCCAGG - Intronic
1001648636 5:173299932-173299954 CTCCTTCTCACGGGCAATCCTGG - Intergenic
1013728784 6:113137054-113137076 TGCCTCCTCACGGGCAATCCTGG - Intergenic
1049347159 8:142145192-142145214 CGCCAACTGGAGTGTAATCCAGG - Intergenic
1195322335 X:103729830-103729852 CACCTTCTGAGGTTCAATCCTGG + Intergenic