ID: 998116724

View in Genome Browser
Species Human (GRCh38)
Location 5:139543461-139543483
Sequence CTGGATTGCACGTCAGTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116718_998116724 -3 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116716_998116724 5 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116714_998116724 13 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116713_998116724 17 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116715_998116724 6 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116717_998116724 -2 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38
998116712_998116724 25 Left 998116712 5:139543413-139543435 CCATTCTGCCTTCCGTGGGCCCA 0: 1
1: 0
2: 0
3: 25
4: 213
Right 998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116724 Original CRISPR CTGGATTGCACGTCAGTAGG CGG Intronic
907091375 1:51729347-51729369 CTGGATGGCACGTTAGAAGCCGG + Intronic
924715055 1:246565826-246565848 CTGGATTGCACTCCAGCAGTAGG + Exonic
1067726333 10:48774001-48774023 CTGGCTTGCACCTCTGTGGGGGG - Intronic
1083271891 11:61576939-61576961 CTGGAAGGCAGGTCAATAGGTGG - Intronic
1083826787 11:65208424-65208446 CAGGATGGCAGGTCAGGAGGAGG - Intronic
1084601386 11:70147806-70147828 CAGGATGGCAGGACAGTAGGAGG - Intronic
1087242423 11:95794236-95794258 CTGGATTACAGCTCAGTAGTGGG + Intronic
1096766246 12:53892715-53892737 CTGGATAGCAGGGCAGTGGGTGG + Intergenic
1098109521 12:67107656-67107678 CTGGCCTCCAGGTCAGTAGGTGG + Intergenic
1101668358 12:106841902-106841924 CTGGGATGCACACCAGTAGGGGG - Intronic
1104585707 12:130046539-130046561 CTGGAATGCACCTCGGTAGGGGG + Intergenic
1107626085 13:42286143-42286165 CTGGATTGCAAGTAAATTGGGGG + Intronic
1115652529 14:35413265-35413287 CTGGATTTCAGGGCAGGAGGAGG + Intergenic
1128184574 15:65633768-65633790 CTGGACTGCAAGTAAGCAGGAGG + Intronic
1142779454 17:2169661-2169683 CTGGGTTGAAGGACAGTAGGAGG + Intronic
1158727252 18:59984852-59984874 CTGGATTTCAAGTCATTAAGAGG - Intergenic
1163610565 19:18299281-18299303 CTGGATTCCACCCCAGCAGGTGG + Intergenic
938801336 2:134766177-134766199 CTGCATTGCACAACTGTAGGGGG - Intergenic
945937740 2:215920325-215920347 CTGGATGGCTCGTCAGAAGATGG - Intergenic
946176136 2:217922856-217922878 CTGGAATGCACGGCTGTGGGCGG - Intronic
946537508 2:220647472-220647494 GTGGAGTGCACGTCAGTGGCGGG + Intergenic
1185094040 22:48796339-48796361 CTGGATTCCACGCAATTAGGGGG - Intronic
954785600 3:53090131-53090153 CTGGATTGCAAGTCAGAACATGG - Exonic
963199051 3:142568550-142568572 CTGTCTTGCACCTCAGAAGGGGG - Intronic
968508068 4:981234-981256 CTGGACTGCGTGTCAGTAGGAGG - Intronic
973826544 4:54712727-54712749 TTGGATTGCCTGTAAGTAGGAGG + Intronic
973955886 4:56062669-56062691 CTGGATTCCACGTCAGCAGAAGG - Intergenic
985181077 4:187263929-187263951 CTGAATTGCACGTCTGTGGGAGG + Intergenic
998116724 5:139543461-139543483 CTGGATTGCACGTCAGTAGGCGG + Intronic
1001165561 5:169362450-169362472 CTGGATTGAAAGACAGAAGGTGG - Intergenic
1001648637 5:173299933-173299955 CAGGATTGCCCGTGAGAAGGAGG + Intergenic
1003415087 6:5899928-5899950 CAGGATTGCACATCAGTGGTAGG - Intergenic
1004138483 6:12991320-12991342 CTGGTTTGCAGGGCAGTAGATGG + Intronic
1022038548 7:26557496-26557518 AGGGATTGCACCTCACTAGGGGG + Intergenic
1035850278 8:2912915-2912937 CTGCATTGCACGTCTCTAAGAGG - Intergenic
1039322772 8:36450816-36450838 CTGGATTGCACTTATTTAGGTGG + Intergenic
1039780444 8:40779829-40779851 CTGGATAGCACCTCAGTGAGAGG + Intronic
1043819943 8:84850451-84850473 CTGCTTTGCAGGACAGTAGGAGG + Intronic
1052997037 9:34556708-34556730 CTGGGATGCAGGTCAGTATGAGG - Intronic
1059321013 9:113469564-113469586 CTGGATTGCACATTATTGGGGGG - Intronic
1060243589 9:121925693-121925715 CTGGACTGCAAGTCAGCAGCAGG + Intronic
1193186314 X:78517301-78517323 CTGGATTCCACGTCATTCTGAGG + Intergenic
1195322334 X:103729829-103729851 CAGGATTGAACCTCAGAAGGTGG - Intergenic