ID: 998116725

View in Genome Browser
Species Human (GRCh38)
Location 5:139543462-139543484
Sequence TGGATTGCACGTCAGTAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116712_998116725 26 Left 998116712 5:139543413-139543435 CCATTCTGCCTTCCGTGGGCCCA 0: 1
1: 0
2: 0
3: 25
4: 213
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116713_998116725 18 Left 998116713 5:139543421-139543443 CCTTCCGTGGGCCCAGCTTCCCT 0: 1
1: 1
2: 5
3: 39
4: 272
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116715_998116725 7 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116717_998116725 -1 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116720_998116725 -10 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116716_998116725 6 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116718_998116725 -2 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data
998116714_998116725 14 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116725 5:139543462-139543484 TGGATTGCACGTCAGTAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116725 Original CRISPR TGGATTGCACGTCAGTAGGC GGG Intronic
No off target data available for this crispr