ID: 998116727

View in Genome Browser
Species Human (GRCh38)
Location 5:139543475-139543497
Sequence AGTAGGCGGGCTGCAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 246}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116715_998116727 20 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116716_998116727 19 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116717_998116727 12 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116720_998116727 3 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116718_998116727 11 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116721_998116727 2 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116714_998116727 27 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246
998116723_998116727 -8 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116727 Original CRISPR AGTAGGCGGGCTGCAGAGGA AGG Intronic
900183261 1:1321704-1321726 TGTGGGAGGGCTGCAGATGAGGG - Intronic
900513395 1:3070521-3070543 GGCGGGCGGCCTGCAGAGGAGGG - Intronic
900626820 1:3612101-3612123 TGCACGCGGGCTGCAGAGGCTGG - Intergenic
900780079 1:4612257-4612279 AGGAGGCGGGGTGGCGAGGAGGG - Intergenic
900915472 1:5635289-5635311 AGTAGGCAGGCTGGAGAAGGAGG - Intergenic
902241248 1:15090804-15090826 AGGAGGCAGGCAGCAGAGAATGG + Intronic
902660281 1:17896113-17896135 AGCAGGCGGGCAGCAGAGCCAGG + Intergenic
902718857 1:18291111-18291133 AGCAGGCGGGCGGCAGCTGAGGG + Intronic
903669842 1:25028846-25028868 AGAAGGGGACCTGCAGAGGACGG - Intergenic
903670449 1:25032188-25032210 AGTGAGCGGGCTGCAGACCAAGG - Intergenic
904287370 1:29461140-29461162 AGGAGGCTGGGGGCAGAGGAGGG + Intergenic
905593936 1:39189134-39189156 AGAAGGCATGCTGCAGAGTAAGG - Intronic
905626338 1:39492358-39492380 AGTAAGCTGGCTGCAGGGGAGGG + Intronic
905670557 1:39788097-39788119 AGTAAGCTGGCTGCAGGGGAGGG - Intronic
906519537 1:46458964-46458986 ATTAGGCCAGCTTCAGAGGATGG - Intergenic
907840916 1:58156690-58156712 AGAAGGCAGGCTGCACAGAAGGG + Intronic
909809445 1:79913259-79913281 TGTAGCTGGGCTGCAGATGATGG + Intergenic
910449552 1:87331620-87331642 TGGAGGCGGGCGGCGGAGGAGGG + Intronic
911156539 1:94642839-94642861 AGTAGGCTGGCTGGAGTGGCTGG - Intergenic
914250376 1:145917512-145917534 ATTAGGCGGACTGGAGAGAATGG - Intronic
916713992 1:167434895-167434917 TGGAGGAGGGCTCCAGAGGAAGG - Intronic
916714130 1:167435290-167435312 TGGAGGAGGGCTCCAGAGGAAGG - Intronic
916714142 1:167435327-167435349 TGGAGGAGGGCTCCAGAGGAAGG - Intronic
919928194 1:202203714-202203736 AGCAGGCGGGGCACAGAGGAGGG + Intronic
921359948 1:214322048-214322070 AGTGGGCTTGCTGCAGAGGAGGG + Intronic
922695485 1:227728948-227728970 GGGCGGCAGGCTGCAGAGGAAGG + Intronic
924939744 1:248804748-248804770 GGCAGGTGGGCTGCAGAGGCAGG + Intergenic
1067043486 10:42970817-42970839 GGCAGCCGGGCTGCAGAGCAAGG - Intergenic
1067344570 10:45428124-45428146 GGTAGGGGGGCTGCGGGGGAAGG - Intronic
1068679447 10:59803803-59803825 AGCAGGCAGGCTGCAGAAGAGGG - Intronic
1070654395 10:78261548-78261570 AGTTGGAGGGCTGGAGAGAAAGG - Intergenic
1071299516 10:84245724-84245746 AGTGGTGGGGCTGGAGAGGATGG - Intronic
1071750178 10:88466559-88466581 TGGAGGCGGGTTGCAAAGGAAGG - Intronic
1075116171 10:119628849-119628871 GGCAGGCTGGCTGCAGAGGCTGG - Intergenic
1075968316 10:126631856-126631878 AGTCCTCAGGCTGCAGAGGAAGG - Intronic
1076070452 10:127484369-127484391 AGTAGGGAGCCTGCAGAGGAGGG - Intergenic
1076474529 10:130743106-130743128 AGGAGGCGGGCAGGTGAGGAAGG - Intergenic
1076474535 10:130743126-130743148 AGGAGGCGGGCAGGTGAGGAAGG - Intergenic
1076992089 11:280655-280677 GCTAGGCGGGCTGCTGAGCAAGG + Exonic
1077532499 11:3103791-3103813 AGGAAGAGGGCTGCAGAGGCAGG - Intronic
1077532524 11:3103891-3103913 AGGAAGGGGGCTGCAGAGGCAGG - Intronic
1077981357 11:7303809-7303831 AGTAGGAGGGCAGCAGGGAAGGG - Intronic
1078258448 11:9681728-9681750 AGAAGGCAGAATGCAGAGGAAGG + Intronic
1078345164 11:10541277-10541299 GGTAGGGGCGCTGCAGAGGAAGG - Intergenic
1078615680 11:12863431-12863453 AGATGGAGGGCTGAAGAGGATGG + Intronic
1080774822 11:35375741-35375763 ATGAGGAGGGCTACAGAGGAGGG + Intronic
1082963589 11:58942589-58942611 AGTAGGCTGGGTGGAGAGGGTGG + Intronic
1082972673 11:59040077-59040099 AGTAGGCTGGGTGGAGAGGGTGG + Intronic
1082977129 11:59083973-59083995 AGTAGGCTGGGTGGAGAGGGTGG + Intergenic
1083379093 11:62249998-62250020 ACTGGGAGGTCTGCAGAGGAAGG + Intergenic
1083612023 11:64008825-64008847 GGCAGGCGGGCAGGAGAGGATGG - Intronic
1083883704 11:65560489-65560511 AGTAGGGGTGCTGGAGAGGTAGG + Intergenic
1084455817 11:69267698-69267720 AGGAGGCAGGCCCCAGAGGAGGG + Intergenic
1084461612 11:69299457-69299479 AGCAGGGGAGATGCAGAGGAGGG + Intronic
1085011016 11:73141933-73141955 AGGAGGAGGGCCGGAGAGGAGGG + Exonic
1085860807 11:80233039-80233061 AGAAGCCGGGCTGAAGGGGAAGG + Intergenic
1087018083 11:93574008-93574030 AGTAGATGTGCTGCTGAGGAAGG + Intergenic
1088014605 11:105043762-105043784 CCTAGGAGGGCTGCAGATGATGG + Intronic
1088037461 11:105334586-105334608 AGCAGGCGTGCTGCACTGGAGGG - Intergenic
1088713101 11:112525782-112525804 AGGAGGCAGGATGCATAGGATGG + Intergenic
1090276944 11:125426964-125426986 AGGAAGCGCGCTCCAGAGGAGGG + Intronic
1090423947 11:126594189-126594211 AGAAGGCAGGCAGAAGAGGAAGG + Intronic
1090463209 11:126910315-126910337 AGTGGGCTGGCTGGAGAGAAGGG + Intronic
1091302447 11:134516065-134516087 AGGAGGAGGGGTTCAGAGGAAGG + Intergenic
1091645948 12:2272377-2272399 AGGAGGCAGGAGGCAGAGGATGG - Intronic
1091982325 12:4876209-4876231 AGTAGAGTGGCTGAAGAGGAAGG + Intergenic
1094238049 12:28190740-28190762 AGCAGGCGGGCTGCAGGCGGCGG - Intronic
1095825970 12:46530974-46530996 AGGTGGGGGGCTGCAGGGGATGG - Intergenic
1096594279 12:52684671-52684693 AGCAGCCAGGCAGCAGAGGAGGG + Intergenic
1099070267 12:78037266-78037288 AGAAGCTGGGCTGAAGAGGAGGG + Intronic
1101580272 12:106036647-106036669 AGTTGGGGGTATGCAGAGGAAGG - Intergenic
1102064135 12:109958824-109958846 AGTAATAGGGCTGGAGAGGAAGG + Intronic
1102469366 12:113150841-113150863 GCTAGGGTGGCTGCAGAGGAGGG - Intronic
1102870601 12:116411120-116411142 AGGAAGAGGGCTCCAGAGGAAGG + Intergenic
1105069606 12:133226686-133226708 AGGAGCTGGGCTGGAGAGGAGGG - Intronic
1106017643 13:25884489-25884511 AGAAGGCAGGCTGCAGAAGGAGG + Intronic
1106594439 13:31124454-31124476 AGGATGCTGGCTGCAGAGGCAGG - Intergenic
1107820502 13:44281441-44281463 AGAAGCCGGGGAGCAGAGGAAGG + Intergenic
1107986392 13:45780214-45780236 AGTGGGTGGGCTGCAGATGGAGG - Exonic
1118603952 14:67489539-67489561 AGAATGGTGGCTGCAGAGGAGGG - Intronic
1118637450 14:67760829-67760851 AGTGGGAGGGGGGCAGAGGATGG + Intronic
1119208228 14:72810445-72810467 AGCTTCCGGGCTGCAGAGGAAGG + Intronic
1123767874 15:23499805-23499827 AGGAGGAGAGCTGCAGAGAAAGG + Intergenic
1124570406 15:30857760-30857782 AGGAGGAGAGCTGCAGAGAAAGG - Intergenic
1124827515 15:33113619-33113641 ATGAGGTGGGCTGTAGAGGAAGG - Intronic
1124992872 15:34693137-34693159 AGATGGAGGGCTGGAGAGGAGGG - Intergenic
1128063349 15:64748839-64748861 TCTAGGCAGGCTGCAGGGGAGGG + Intronic
1128082406 15:64864493-64864515 GGTAGGTGGGTTGCAGAGAAGGG + Intronic
1128133118 15:65243893-65243915 TGTGGAAGGGCTGCAGAGGAGGG - Intronic
1130831411 15:87604829-87604851 ACTAGGGGGGATCCAGAGGAGGG + Intergenic
1131295474 15:91144760-91144782 AATAGGCTGGCTGCCAAGGAAGG - Intronic
1131329599 15:91484817-91484839 TGTAGGCAGGCTGCAGAAGGTGG + Intergenic
1132382880 15:101378930-101378952 ACAATGCGGGCTGCAGAGGAAGG - Intronic
1132421765 15:101676125-101676147 AGTCGGGGGGCTGCATACGATGG + Intronic
1132862127 16:2076886-2076908 AGGCTGGGGGCTGCAGAGGAGGG - Intronic
1133229761 16:4360921-4360943 GGTAGGACGGCTGCAGAGGTGGG - Exonic
1134207194 16:12247978-12248000 GGTGGGAGGGCTGCAGTGGAGGG - Intronic
1134687610 16:16169691-16169713 AGTAGGTGGGCAGCAGACGCAGG - Exonic
1135738262 16:24951050-24951072 AGTAGGCACTCTGGAGAGGAGGG + Intronic
1138434570 16:56989844-56989866 AGTTGCCGGCCCGCAGAGGATGG + Intronic
1138532037 16:57639769-57639791 AGGAGGCGAGCTGGAGGGGAAGG - Intronic
1139141791 16:64273023-64273045 AGGAGCTGAGCTGCAGAGGAAGG - Intergenic
1139341735 16:66271884-66271906 AGTGGGCAGGCTACAGGGGAGGG + Intergenic
1139397170 16:66649632-66649654 AGTGGGGAGGCTGCTGAGGACGG - Intronic
1139514486 16:67445247-67445269 AGCAGGCGGGGGGCAGAGGCTGG + Intronic
1140201833 16:72901200-72901222 ACTCAGCGGGCTGCAGAGCAAGG - Intronic
1140357488 16:74318911-74318933 AGCAGGGGAGCTGCAGAGGCCGG - Intergenic
1141611261 16:85182329-85182351 ACCAGGCAGGCTCCAGAGGATGG + Intronic
1142257857 16:89023941-89023963 AGGAGGGGGTCTGCAGAGGCAGG + Intergenic
1142509341 17:384783-384805 AGCAGCCAGGCTGCAGAGGATGG + Intronic
1143010842 17:3865471-3865493 GGCTGGCGGGCTGTAGAGGAGGG - Exonic
1143644588 17:8222107-8222129 AGAATGCGAGCTGGAGAGGAAGG + Intergenic
1143651066 17:8264615-8264637 AGGAGGCAGGGGGCAGAGGAAGG - Intronic
1145999338 17:29121948-29121970 AGTTGACTGGCTGCAGGGGAGGG + Exonic
1147437479 17:40426091-40426113 ATTCTGTGGGCTGCAGAGGAAGG - Intergenic
1147907775 17:43833701-43833723 AGAAGTCAGGCTGGAGAGGAGGG + Intergenic
1148124849 17:45231313-45231335 AGGAGGGAGGCTGCAGAGGCTGG + Intronic
1148618506 17:49017027-49017049 AGGAGGCGGGGTGGGGAGGAAGG + Intronic
1149660566 17:58332230-58332252 AGGAGGAGGGCTGGAGAGTAAGG - Intergenic
1150007582 17:61479311-61479333 AGCAGACGGGCGGCAGAGCACGG - Intronic
1150344503 17:64393930-64393952 GGTAAGGGGGTTGCAGAGGAAGG - Intronic
1151324297 17:73369379-73369401 ACAAGGCCCGCTGCAGAGGAAGG + Intronic
1151668548 17:75558990-75559012 AGGAGGCGGGGTGCAGATGGAGG - Intronic
1155133453 18:22962690-22962712 GGTAGGGGGGGTGGAGAGGAGGG - Intronic
1155431195 18:25760594-25760616 AGGAGGCGGGATACAGGGGAAGG + Intergenic
1157177141 18:45461954-45461976 GGTAGGAGGGATGCAGAGGGTGG + Intronic
1157356639 18:46941225-46941247 GGTAGGGGGGCTGCTGAGGCAGG + Intronic
1158478836 18:57803238-57803260 AAAAGGGCGGCTGCAGAGGAAGG - Intergenic
1158529660 18:58247601-58247623 AGGAGGCGGGCAGCAGGAGAAGG - Intronic
1159893387 18:73973913-73973935 AGTAGAGGAGATGCAGAGGAAGG - Intergenic
1160377285 18:78422571-78422593 ACGAGGCCGGCTGCAGAGGGAGG + Intergenic
1162152590 19:8656506-8656528 AGAAGGTGGGCTGCAGGAGAAGG - Intergenic
1162654189 19:12116503-12116525 AGTATGGAGGCTGCAGAGGGAGG + Intronic
1162954443 19:14090495-14090517 AGGAGGCGGGCAGCGGCGGAGGG - Exonic
1164591971 19:29512290-29512312 AGGAGGGGGGATGCGGAGGAAGG + Intergenic
1166044794 19:40223537-40223559 GGAAGGCGGGCTGCAGATGGGGG + Exonic
1166373142 19:42313511-42313533 GGCCGGCGGGCCGCAGAGGAGGG - Intronic
926102653 2:10129311-10129333 AGTAGGCGAGTATCAGAGGATGG + Exonic
926385063 2:12327758-12327780 AGTAGACCTGCAGCAGAGGAAGG - Intergenic
926536958 2:14124803-14124825 AGAAGGCAGGCTTCAGAGGCAGG - Intergenic
926916806 2:17900316-17900338 GGTAGGTGGGATGCAGTGGAAGG + Intronic
927213605 2:20653353-20653375 TGTTGGGGGGCTGCAGAGAAGGG + Intergenic
927871651 2:26627934-26627956 AGGAGGCTGGCTCCTGAGGAAGG - Intronic
930136253 2:47906147-47906169 AGTGGGCGGGCGGGTGAGGAAGG + Intergenic
934564099 2:95328948-95328970 AAGAGGGGAGCTGCAGAGGAGGG + Intronic
935106762 2:100052037-100052059 AGGAGGAGGACTGCAGAGGGTGG + Intronic
935648606 2:105363073-105363095 ATCAGGTGGGCTGCAGAGGAAGG + Intronic
936072768 2:109382425-109382447 AGGAGGTGGGCTGCTGAGGGAGG - Intronic
937397256 2:121547555-121547577 AGTTTGGGGGCAGCAGAGGAAGG - Intronic
937422375 2:121768874-121768896 ACTAGGCAGGCTGAAGAGGGAGG - Intergenic
938051813 2:128180136-128180158 AGCATGCAGGCTTCAGAGGAAGG - Intronic
938082453 2:128377421-128377443 AGCAGATGGGCTGCATAGGAAGG - Intergenic
938272030 2:129980763-129980785 AGTAAGGGGGCTTCTGAGGAAGG - Exonic
938443977 2:131363051-131363073 AGTAAGGGGGCTTCTGAGGAAGG + Intergenic
941195512 2:162446274-162446296 AGGAGGAAGGCTGCAGAGTAGGG + Exonic
941540124 2:166771799-166771821 AGAAGCTGGGCTGAAGAGGAAGG - Intergenic
944541103 2:200754620-200754642 GGTAGGCTGGCTGCAGAGATGGG - Intergenic
946269204 2:218576119-218576141 AGGAGGCGGGCAGTAGAAGAAGG - Intronic
947343437 2:229164762-229164784 AGTTTGCAGGCTGCAGAGCAGGG + Intronic
947684914 2:232074914-232074936 ACTAGCAGTGCTGCAGAGGAAGG + Intronic
948028583 2:234798532-234798554 GGTAGGTGGGCTTCAGAGAAGGG - Intergenic
948770820 2:240250538-240250560 AGAAGGAGGGCTGAAGAGGGAGG + Intergenic
1169135047 20:3192152-3192174 AGATGGCTGGATGCAGAGGATGG - Intronic
1169141131 20:3228080-3228102 AGTGGGCGGGCTGGGGAGGCTGG - Intronic
1169819908 20:9699089-9699111 AGTACAGGGGATGCAGAGGAGGG - Intronic
1172144166 20:32744465-32744487 AGGAGGAGGGCTGGTGAGGAAGG - Intergenic
1173051031 20:39561960-39561982 AGTAGGGGATCTTCAGAGGAGGG + Intergenic
1173706057 20:45111079-45111101 AGTGGGAGGGCAGTAGAGGATGG - Intronic
1175943581 20:62548802-62548824 AGGAAGTGGGCTGCAGGGGAGGG + Intergenic
1176266609 20:64212522-64212544 AGGGGGCGGCCTGCAGAGGAGGG + Intronic
1180859392 22:19068661-19068683 AGGACAAGGGCTGCAGAGGAAGG - Intronic
1182044613 22:27264463-27264485 AGCAGACAGGCTGCAGAAGATGG + Intergenic
1183240229 22:36652370-36652392 AGAGGGAGGGCTGCAGAGGTAGG - Intronic
1183393170 22:37557235-37557257 TGGAGGCAGGCTGCAAAGGAGGG + Intergenic
1183745064 22:39687275-39687297 TGGAGGCAGCCTGCAGAGGAAGG + Exonic
1184036242 22:41919724-41919746 AGCAGGGGGGCTGCCGGGGAGGG - Intergenic
1184583776 22:45434237-45434259 AGCAGGCGGGCCGACGAGGAAGG + Intergenic
1184689558 22:46111245-46111267 AGTAGGCAGCCTGCTCAGGATGG + Intronic
1184772820 22:46607849-46607871 AGGTCGCAGGCTGCAGAGGAAGG - Intronic
1184857465 22:47154218-47154240 AGGAGGTGGGCTGGAGGGGAGGG - Intronic
1185087777 22:48749940-48749962 AGTGGGCGGGCGGCAGAGAACGG - Exonic
1185210020 22:49565425-49565447 TGTAGGTGGTCTGCAGCGGAGGG + Intronic
949691569 3:6646284-6646306 AGTAGGCAGGCTGCAGGGGGTGG + Intergenic
950582677 3:13872758-13872780 AGCAGGAGGGCTGCAGTGCAGGG - Intronic
954073153 3:48157979-48158001 GGTAGGTGGGCTCCACAGGATGG - Exonic
954073518 3:48160041-48160063 AGTAGTGGGGCTGCAGGGGCTGG - Intronic
954793033 3:53146769-53146791 AGGAGGTGGGCTGCAAAGGGAGG + Intergenic
959480050 3:106860878-106860900 ATTAGGCAAGCTGCAGATGAGGG - Intergenic
959614488 3:108331830-108331852 GGGAGGCAGGCAGCAGAGGAAGG - Intronic
960036225 3:113105356-113105378 TGTAGGCCCGCAGCAGAGGATGG + Intergenic
960534280 3:118799496-118799518 AGTAATCTGGCTGCAGTGGAGGG + Intergenic
961026327 3:123561075-123561097 AGTAGCGGGGGGGCAGAGGAGGG + Intronic
961188064 3:124933106-124933128 AGAAGGCTAGCTGCACAGGAGGG - Intronic
963851575 3:150215581-150215603 AGGAGGCTGGATGCAGAAGATGG + Intergenic
968653807 4:1770231-1770253 AGGAGGAGGGCTGGTGAGGAGGG + Intergenic
969637902 4:8379967-8379989 AGGATGTGGCCTGCAGAGGAGGG + Intronic
978596074 4:110379010-110379032 AGAAGCGGGGCTGAAGAGGAAGG + Intronic
982217699 4:153096295-153096317 AGGAGGAGGGCTGGAGAGGGTGG + Intergenic
982859057 4:160425721-160425743 AGTATGGGGGATGAAGAGGAAGG - Intergenic
984017524 4:174443593-174443615 AGTAGGAGGGAAGAAGAGGAAGG - Intergenic
984577904 4:181472758-181472780 GGCAGGCTGGCTGCAGAGCAGGG - Intergenic
985421377 4:189788285-189788307 AGTAGGCAGGCGGCAAAGAAGGG + Intergenic
986354465 5:6910100-6910122 AGTCTGCAGGCTGCGGAGGATGG - Intergenic
989354609 5:40529446-40529468 AGTAGATGGGATGCAGAGGTTGG + Intergenic
990947475 5:61263970-61263992 AGGAGGAGGCCAGCAGAGGATGG + Intergenic
992738402 5:79746875-79746897 ACAAGGCGGGGTGCAGGGGAGGG - Intronic
998012937 5:138709663-138709685 AGTCCCCGGGCAGCAGAGGAAGG - Intronic
998116727 5:139543475-139543497 AGTAGGCGGGCTGCAGAGGAAGG + Intronic
999204192 5:149836555-149836577 AGAAGGCGTCCTGCAAAGGAAGG + Exonic
1000937194 5:167316955-167316977 ATTAGGGGGTGTGCAGAGGAAGG - Intronic
1001999107 5:176187141-176187163 AGCTGGCAGGCTGCAGAAGAGGG + Intergenic
1002791561 6:441276-441298 AGTGGCTGGGCTGCAGAAGAGGG - Intergenic
1003196834 6:3921876-3921898 GGTGGGGGGGCAGCAGAGGATGG + Intergenic
1005582979 6:27251193-27251215 TGTGGGCGGACCGCAGAGGAAGG - Intronic
1007411462 6:41664505-41664527 AGTGGGGGCCCTGCAGAGGAGGG + Intergenic
1007822559 6:44571434-44571456 AGCAGGTGGGCTTCAGTGGAAGG - Intergenic
1009899830 6:69797155-69797177 TGTGGGAGGGCTGCAGAGCAGGG + Intergenic
1011853612 6:91661313-91661335 AATACAAGGGCTGCAGAGGAGGG - Intergenic
1015312694 6:131782711-131782733 AGCAGGCAGGCTGCAGTGGCAGG + Intergenic
1018471364 6:164101179-164101201 AGGAGGGGGGCTGCAGATGGAGG - Intergenic
1018471371 6:164101199-164101221 AGGAGGGGGGCTGCAGATGGAGG - Intergenic
1018471393 6:164101261-164101283 AGGAGGGGGGCTGCAGATGGAGG - Intergenic
1019900725 7:4018854-4018876 AGGAGGCGGGGAGCAGAGAATGG + Intronic
1022981783 7:35611157-35611179 GGTAGGGTGGCTGGAGAGGAGGG + Intergenic
1023852427 7:44157878-44157900 AGGCGCCGGGCTGCAGAGCAGGG + Intronic
1024107719 7:46109905-46109927 GGCAGGCAGTCTGCAGAGGAGGG - Intergenic
1025710160 7:63900938-63900960 AGGAGGCGGGCAGCCCAGGAGGG + Intergenic
1025998784 7:66545175-66545197 GCTAGGCTGGCTGCAGAGGGAGG - Intergenic
1026966669 7:74444504-74444526 AGCAAGAGGGCTGCACAGGAAGG + Intergenic
1027697453 7:81430009-81430031 AGTAGGCTGGGTGGAGTGGAAGG + Intergenic
1029359953 7:100081480-100081502 AGAGGACGGGCTGCAGGGGACGG + Intronic
1030069156 7:105683959-105683981 AGAAGGGGGCCTGCAGAGAATGG - Intronic
1031569564 7:123342310-123342332 GGTAGGCAGTCTCCAGAGGATGG + Intergenic
1031716460 7:125114870-125114892 AGGAGGCTGACTTCAGAGGATGG - Intergenic
1032550423 7:132779467-132779489 GGAAGGCAGGCTGCAGAGCAGGG - Intergenic
1034422232 7:150996052-150996074 AGGAGGAGGGGTGCAGAGGTGGG - Intronic
1035161029 7:156950019-156950041 AGCACGCCGGCTGCAGAGGACGG + Exonic
1037891681 8:22627039-22627061 GGCAGGCGGCCTGCAGAGGCAGG - Intronic
1038777603 8:30544964-30544986 TGTGGAAGGGCTGCAGAGGAAGG + Intronic
1039187764 8:34935871-34935893 AGTATTGGGGCTACAGAGGAAGG - Intergenic
1044745549 8:95367190-95367212 AGGGGGTGGGCTGCAGATGAAGG - Intergenic
1045649660 8:104329998-104330020 AGTAGTCGGGCGGCCGGGGAGGG - Intergenic
1048866313 8:138764254-138764276 CGTGGGTGGGATGCAGAGGAAGG + Intronic
1053138326 9:35665462-35665484 AGGAGACGGGCTGCAGATGCTGG + Intronic
1055556104 9:77475562-77475584 AGTGGTCTGGCTCCAGAGGAGGG + Intronic
1058789098 9:108423705-108423727 ATTAGGCGGCCTGTAGAGGGAGG - Intergenic
1059985814 9:119819243-119819265 AGCTGGTGGGTTGCAGAGGAAGG - Intergenic
1061601628 9:131674361-131674383 AATAGGCGCCCTGCAGAGCACGG + Intronic
1061669420 9:132180315-132180337 TGCAGGCTGGCAGCAGAGGATGG - Intronic
1062477592 9:136736368-136736390 CGCAGGCTGGCTGCAGAGGCAGG - Intergenic
1062586638 9:137252627-137252649 AGGAGACGGGCTGCAGGGCAGGG - Intronic
1062609483 9:137367585-137367607 TGGAGGCGTGCAGCAGAGGAGGG + Intronic
1203542908 Un_KI270743v1:106812-106834 AGTCTGTGGGCTGCACAGGATGG - Intergenic
1187689928 X:21856379-21856401 AAGGGGCGAGCTGCAGAGGAAGG - Exonic
1189759747 X:44309367-44309389 AGTAGGCGAGTATCAGAGGATGG - Intronic
1190792660 X:53714575-53714597 AGTAGGCGGGCTGGAGAAGCAGG + Intergenic
1194286600 X:92019108-92019130 AGAAGCTGGGCTGAAGAGGAAGG + Intronic
1196334764 X:114518737-114518759 TGTGGGAGGGCTGCAGAGGTTGG - Intergenic
1199215191 X:145254121-145254143 AGTGGGCAGGAGGCAGAGGAAGG + Intronic
1199680497 X:150221239-150221261 GAGAGGAGGGCTGCAGAGGAGGG - Intergenic
1200604146 Y:5243668-5243690 AGAAGCTGGGCTGAAGAGGAAGG + Intronic