ID: 998116728

View in Genome Browser
Species Human (GRCh38)
Location 5:139543476-139543498
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116716_998116728 20 Left 998116716 5:139543433-139543455 CCAGCTTCCCTCTATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 158
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116718_998116728 12 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116717_998116728 13 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116720_998116728 4 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116723_998116728 -7 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116714_998116728 28 Left 998116714 5:139543425-139543447 CCGTGGGCCCAGCTTCCCTCTAT 0: 1
1: 0
2: 3
3: 30
4: 327
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116715_998116728 21 Left 998116715 5:139543432-139543454 CCCAGCTTCCCTCTATACCCACG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data
998116721_998116728 3 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116728 5:139543476-139543498 GTAGGCGGGCTGCAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr