ID: 998116729

View in Genome Browser
Species Human (GRCh38)
Location 5:139543487-139543509
Sequence GCAGAGGAAGGGCGCTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116717_998116729 24 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116720_998116729 15 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116723_998116729 4 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116721_998116729 14 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183
998116718_998116729 23 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116729 Original CRISPR GCAGAGGAAGGGCGCTGTTC TGG Intronic
900464556 1:2818946-2818968 GCCTAGGAATGGCGCTGTCCAGG - Intergenic
902194443 1:14787992-14788014 GCACAGGAATGGCTCTGTACAGG + Intronic
907393782 1:54175990-54176012 GCAGAGTGATGGCTCTGTTCTGG - Intronic
907512307 1:54970725-54970747 GAAGAGAAAGGGGGCTGGTCGGG + Intergenic
909288658 1:73854392-73854414 GGAGAGGAAGGGCTGTCTTCTGG - Intergenic
910445787 1:87297909-87297931 GCAGAGGAAGGGACCTGAACTGG - Intergenic
911284562 1:95974447-95974469 GCAGAGCTAGTGCGCTGTGCTGG + Intergenic
912255101 1:108050326-108050348 GCAGAGGAAGGGCGGTGTCCAGG + Intergenic
912376216 1:109212048-109212070 GCAGAGGAAAGGGGCTTGTCTGG - Intergenic
915014867 1:152723723-152723745 GCACAGGCAGGGCTCTGTTGGGG + Intergenic
920653455 1:207855933-207855955 GCAGAGGAAGGGCTGTGTATTGG - Intergenic
923260537 1:232263933-232263955 CCATAGGAAAGCCGCTGTTCTGG + Intergenic
1067157346 10:43793134-43793156 GGAGAGGAAAGGCCCTCTTCAGG - Intergenic
1070458722 10:76643626-76643648 GCAGAGGAAGGGCTGTGCTGAGG - Intergenic
1071145288 10:82562715-82562737 CCAGAGGAATGGTGCTGCTCAGG - Intronic
1071152737 10:82653732-82653754 GCAGAGGAAGGGCAATGGTTTGG + Intronic
1071328763 10:84540989-84541011 GGAGAGGGAGGGCGCGGTGCGGG + Intergenic
1072208708 10:93226629-93226651 GAAGAGGAAGGGTCCTGGTCTGG + Intergenic
1073480474 10:103783418-103783440 GCAGAGGAAGAGGGCAGATCCGG + Intronic
1074560873 10:114534212-114534234 GAAGGGGAAGGGTGCTGCTCTGG + Intronic
1075086265 10:119416271-119416293 GCAGAGGCAGGGAGCAGTGCCGG + Intronic
1075345434 10:121678709-121678731 GCAGCGGCAGGACCCTGTTCTGG - Intergenic
1076129778 10:128005702-128005724 GCAGAGGGAGGACGCTGGGCAGG + Intronic
1076729130 10:132429575-132429597 TCCCAGGAAGGGTGCTGTTCTGG - Intergenic
1077462614 11:2718186-2718208 GCAGAGGAAGGCAGCTGTCAGGG - Intronic
1078454404 11:11463993-11464015 GCAGAGGAAGGAGGCAGTCCCGG + Intronic
1079130574 11:17744719-17744741 GCAGGGGATGGGTGCTGTGCTGG + Intronic
1080406535 11:31985030-31985052 GGAGAGGAAGGACTCTGTGCAGG - Intronic
1083736954 11:64686817-64686839 CCAGTGGAAGGGCCCTGTGCCGG - Intronic
1086532304 11:87800696-87800718 GCAGAGCTCGAGCGCTGTTCTGG + Intergenic
1088320335 11:108549000-108549022 GAAGAGGAAGAGCGTTGTGCAGG - Intronic
1090385338 11:126355187-126355209 GCAGAGGAAGGGCCCACGTCTGG + Intergenic
1093020044 12:14194910-14194932 GCAGAGGAATGACGCTGTCGAGG + Intergenic
1095099039 12:38162603-38162625 GGAGAGGAAGCGCTCTGCTCTGG + Intergenic
1096112547 12:49038048-49038070 GCAGGGGGAGGGCGCTCCTCAGG + Exonic
1097059628 12:56272884-56272906 GCAGGGGAAGGGAGCTGATTAGG + Exonic
1100712840 12:97276030-97276052 GCAGAGGCAGGGCACTGTGGTGG + Intergenic
1101186857 12:102289544-102289566 GCAGAGGGGGTGCGCTGTGCTGG + Intergenic
1103975748 12:124701463-124701485 GCAGAGGGAGGCCGCTGGCCTGG + Intergenic
1104985133 12:132592374-132592396 GCAGAGGGCAGGCGCTGTGCCGG - Intergenic
1105733404 13:23243579-23243601 GCAGAGAAAGTAAGCTGTTCTGG - Intronic
1106874177 13:34054281-34054303 GCAGAGCTCGGGCGCTGTGCTGG + Intergenic
1107343268 13:39432463-39432485 GCAGAGGAGGGGAGCATTTCAGG - Intronic
1108333605 13:49415666-49415688 GCACAGGAAGGGTGCTGATTTGG + Intronic
1108473183 13:50787849-50787871 GCAGAGGGAAGGCGCTGAGCTGG - Intronic
1112752511 13:102597100-102597122 GCAGAGGAAGGAGGCGGCTCCGG - Exonic
1113539878 13:111098242-111098264 GCAGCGTAAGGCCCCTGTTCTGG + Intergenic
1113654521 13:112059374-112059396 GCAGAGAAAGAGCCCTGTTTTGG - Intergenic
1118304050 14:64639770-64639792 GCAGAGAAAGGGAGCTGCTCAGG - Intergenic
1119714214 14:76847119-76847141 GCCGAGGAAGGGTGCAGTGCAGG + Intronic
1119756464 14:77123617-77123639 GCAAAGGAGGGGCTCTGTTCTGG - Intronic
1119854759 14:77891220-77891242 GCAGTGGAAGGGAGCTGACCAGG + Intronic
1121037176 14:90716027-90716049 GCAGAGTAAGGACTTTGTTCAGG + Intronic
1122178394 14:99937477-99937499 GCAGAGGCAGAGCTGTGTTCAGG + Intronic
1122203806 14:100138285-100138307 GCAGAGGAAGGACTCTGGGCTGG - Intronic
1123687364 15:22808426-22808448 GCAGAGGTAGGGCGTGGCTCAGG + Intronic
1125852987 15:42921661-42921683 GCGGAGCAAGGACGCTGTGCAGG + Intergenic
1126652387 15:50937833-50937855 GCAGTGGAAGGGCGGTATTGTGG + Intronic
1126938093 15:53734458-53734480 GCAGAAGAAGGTCCATGTTCTGG - Intronic
1127755623 15:62089036-62089058 GCAGTGGAGGGGAGCTCTTCAGG + Intergenic
1127882908 15:63173984-63174006 GTGAAGGAAGGGCACTGTTCTGG - Intergenic
1128080484 15:64854232-64854254 GAAGAGGCTGGGCACTGTTCTGG + Intronic
1128317646 15:66671194-66671216 GCAGAGGAAGGGCGGGGTAGAGG - Intronic
1128371653 15:67044197-67044219 GCAGAGGAAATTCCCTGTTCTGG - Intergenic
1129278033 15:74460354-74460376 GCAGGGGTAGGGCTCTGTTGGGG - Intronic
1130046271 15:80447554-80447576 GCTTAGGAAGGTCCCTGTTCAGG - Intronic
1136245809 16:28975162-28975184 GCTGAGGAAGGGCGCGGTGTCGG - Exonic
1137352428 16:47725139-47725161 GCAGAGCAAGGGCGCTTTCGAGG + Intergenic
1137531877 16:49283075-49283097 GGAGAGGAAGGGCGCGCTCCAGG + Intergenic
1138229891 16:55329122-55329144 GCAGAGGCAGGAGGCTGTCCAGG - Exonic
1139446551 16:67001762-67001784 GCAGATGGTGGGCTCTGTTCAGG - Intronic
1141552052 16:84812828-84812850 ACAGAGGAAGCATGCTGTTCAGG + Intergenic
1141663741 16:85455105-85455127 GCAGCCGCAGGGCGCTGCTCAGG - Intergenic
1142183865 16:88685425-88685447 GAGCAGGAAGGGCGCTGTTGGGG - Intronic
1142702656 17:1673549-1673571 GCAGAGGCCGGGCGGTATTCTGG - Exonic
1142970862 17:3610689-3610711 GCAGTGGGAGTGCGCTGTCCAGG - Exonic
1145799769 17:27675579-27675601 TCAGAGGAAGGGCCTAGTTCAGG + Intergenic
1148974142 17:51512080-51512102 GCACAGCAGGGGTGCTGTTCTGG - Intergenic
1151422097 17:74005337-74005359 GAACAGGAAAGGGGCTGTTCTGG - Intergenic
1151894108 17:76968838-76968860 GGAGAGGAAGGGTGGTGTTTGGG - Intergenic
1152614691 17:81332378-81332400 GCAGGGGGAAGGCGCTGTTCAGG - Intergenic
1154251829 18:12751168-12751190 GCAGAGCAAGGGCGCCGTCCTGG - Intergenic
1158860015 18:61582533-61582555 GCAGAGGAAGGAAACTATTCAGG + Intergenic
1160578519 18:79870476-79870498 GCAGAGGGAGCGCGCAGCTCTGG - Intronic
1160890821 19:1377886-1377908 TCAGATGCAGGGCGCTGTGCGGG + Exonic
1160913061 19:1483666-1483688 GCAGAGGAAGTGCGCCGTCCGGG - Exonic
1160951152 19:1667923-1667945 GCAGAGGGAGGGCGCTGGGTCGG + Intergenic
1161151395 19:2711993-2712015 GAAGAGGTAAGGCGTTGTTCAGG - Intergenic
1162782042 19:13011533-13011555 GCAGAGGCAGGGGGGTGTGCCGG + Intronic
1162917271 19:13881243-13881265 GCAGAAGGATGGGGCTGTTCTGG + Intergenic
1164888804 19:31805532-31805554 GCAGAGGAAGGGCTTAGCTCGGG + Intergenic
1167378291 19:49123979-49124001 GCAAAGGAGGGGGGCTGTTCTGG - Intronic
1167491015 19:49792650-49792672 GCAGGTGATGGGCGCTGTTGGGG - Intronic
1168186452 19:54703289-54703311 GCAGAGGAAGGGGGCTATGGTGG - Intergenic
928949610 2:36803095-36803117 GCACAGGGAGGGCGTGGTTCTGG - Intronic
929801510 2:45108445-45108467 GCAGAGACAGGGCCCTGTTTGGG - Intergenic
930755264 2:54966904-54966926 GCAGAGGCTGGGCAGTGTTCTGG + Intronic
933710553 2:85322519-85322541 GCAGAGGTAGGGGGCTGCTTTGG - Exonic
934921543 2:98348159-98348181 GAAGAGGAAGTGCGGTGTTTGGG - Intronic
934949162 2:98564544-98564566 GCAGAGGAAGGGGGCGGTGGGGG + Intronic
935099731 2:99982042-99982064 GCTGAGGAAGAGCCCTGTGCAGG - Intronic
935625489 2:105169152-105169174 CCAGAGGCAGGGCATTGTTCTGG - Intergenic
936587701 2:113772905-113772927 TCATAGGAAGGGCACTATTCAGG - Intergenic
936760708 2:115777813-115777835 CCAGAGGAAGGCAGCTGTACAGG + Exonic
938016504 2:127871760-127871782 GCAGATGAACGGGGCTGTGCAGG - Intronic
938459595 2:131489037-131489059 GGAGAGGCAGAGCGCTGTCCAGG - Intronic
942659342 2:178247600-178247622 ACAGAGGAGGGGTGCTGTTGTGG - Intronic
946374810 2:219301687-219301709 GCAGAGGCTGGCCGCTGTGCTGG - Exonic
947681360 2:232037048-232037070 GCAGAGCTAGAGCGCTGTGCTGG + Intronic
947923902 2:233904281-233904303 GCAGAGGAAGGGCCCTACACAGG + Intergenic
948792976 2:240388720-240388742 GCAGAGATAGGGCTCTGTCCTGG + Intergenic
1170914821 20:20612682-20612704 GAAGAGGAAGGGCTATCTTCTGG + Intronic
1170960295 20:21019854-21019876 GCAGAGAAAGGGGGCTGGGCAGG - Intergenic
1171209301 20:23304659-23304681 GCAGAGGCAGGATGCTGTTGGGG - Intergenic
1172408991 20:34708926-34708948 GGAGGGGAAGGGCGCTGCTGGGG + Intronic
1175584242 20:60125196-60125218 GCAGAGGCAGGGCTCTGTGCTGG + Intergenic
1176130085 20:63493115-63493137 GGTGAGCAAGGGCGCTGTGCTGG - Exonic
1176226807 20:64004944-64004966 GCACAGGAATGGCACAGTTCAGG + Intronic
1179200930 21:39219990-39220012 GAAGAGGAAAGACGCTGTACAGG + Intronic
1180050556 21:45329232-45329254 GCAGAGGATGGGGGCTGTTAGGG - Intergenic
1180187206 21:46145743-46145765 GAGGGGGAAGGGCGCTGTTGGGG - Intronic
1181910494 22:26234560-26234582 ACAGAGGAAGAATGCTGTTCTGG - Intronic
1182001561 22:26924138-26924160 GGAGAGGAAGGATGCTGTTAGGG + Intergenic
1182528815 22:30939667-30939689 GCAGAGTGATGGCTCTGTTCTGG + Exonic
1184891150 22:47380122-47380144 GCAGAAGACGTGCGCTGCTCCGG - Intergenic
1185015209 22:48338897-48338919 GCAGAGGCCGGGCCCTGCTCAGG - Intergenic
1185368027 22:50445848-50445870 GCAGAGGCAGGGCCCAGTGCTGG - Exonic
952382283 3:32815126-32815148 GCAAAGGAGGGGCTCTGTTTTGG + Intergenic
952888358 3:38025174-38025196 GCACTGGAAGGGCGGTGTCCAGG + Intronic
953138662 3:40206578-40206600 TCAGAGGAAGGGCCCTCATCTGG - Intronic
955462972 3:59205504-59205526 GCACAGGTAGGGCGGTCTTCTGG + Intergenic
955481462 3:59394545-59394567 CCAGAGGGAGGGCTCTGCTCCGG - Intergenic
957965780 3:87321354-87321376 GCAGAGGAAGGGATCTCTTCTGG - Intergenic
958877174 3:99629757-99629779 GCAAAGGAAGGACACTGTTCAGG - Intergenic
959521541 3:107327629-107327651 GCAGGGGAAGGGAGCTGGTTAGG + Intergenic
960278228 3:115751499-115751521 GCAGAGCTAGAGCGCTGTGCTGG - Intergenic
966242081 3:177765998-177766020 GCAGGGGAGGGGCGTTGTTTAGG + Intergenic
968563109 4:1295482-1295504 GGAGAGGAAGGAGGCTGCTCTGG - Intronic
969422111 4:7103470-7103492 GCCAAGGAAGGGCGGGGTTCGGG - Intergenic
974029415 4:56762726-56762748 GCAAAGGCAGGGCGCAGTCCAGG + Intergenic
976312998 4:83630976-83630998 GCAGAGGAAGGGGGAGTTTCAGG + Intergenic
977086110 4:92600910-92600932 GTAGAGGAAGTGCACTGTGCTGG + Intronic
977561610 4:98538468-98538490 TCAGAGGAATGGCCCTGCTCTGG - Intronic
977678644 4:99774526-99774548 GCAGAGCAAGTGTGCTGCTCTGG - Intergenic
994991252 5:106999767-106999789 GCAGAGCTCGGGCGCTGTGCTGG + Intergenic
997226033 5:132210219-132210241 GCAGAGGAACTGCACTGTGCTGG - Intronic
997362940 5:133306611-133306633 GCAGAGGAAGTGCCTTGTTGGGG - Intronic
998116729 5:139543487-139543509 GCAGAGGAAGGGCGCTGTTCTGG + Intronic
1001652726 5:173327390-173327412 GCAGAGGAGGCGCACGGTTCGGG + Intronic
1004303217 6:14476962-14476984 GGAGAGAAAGGGCTCTCTTCTGG + Intergenic
1005274243 6:24199137-24199159 GCAGAGCTCGAGCGCTGTTCTGG - Intronic
1006453400 6:34118405-34118427 GCAGGGGCAGGGCACTGTGCTGG + Intronic
1011696902 6:89921263-89921285 CCAGGCGAAGGGCCCTGTTCAGG + Intergenic
1015509770 6:134026757-134026779 GCAGAGGAAGGGCCATGTCTTGG + Intronic
1016688900 6:146912969-146912991 GCAGAGACAGGGTGGTGTTCAGG - Intergenic
1016848039 6:148588432-148588454 GAAGAGTTAGGGCCCTGTTCTGG - Intergenic
1016887479 6:148971494-148971516 GCAGAGACATGGCGCTGTCCAGG + Intronic
1016997028 6:149967931-149967953 ACAGAGGATGGACGTTGTTCTGG + Intronic
1018936253 6:168275803-168275825 TGAGAGGAAGGACACTGTTCCGG - Intergenic
1024107717 7:46109893-46109915 GCAGAGGAGGGGCACAGTCCTGG - Intergenic
1026563391 7:71469114-71469136 GCAGAGGAGGGAAGGTGTTCTGG + Intronic
1028613484 7:92738225-92738247 GCAGAGGAAGGGGGATCTTCAGG + Intronic
1029250604 7:99233490-99233512 GCAGGGGAAGGAGGCTGATCTGG - Intergenic
1029336322 7:99902878-99902900 TCAGAGGAAGGGCTCTGTTGGGG - Intronic
1029375994 7:100177300-100177322 CCAGAGAAAGAGCGCTGCTCCGG + Exonic
1030064924 7:105652274-105652296 GCAGAGGAAAGGCACTGAGCAGG - Intronic
1030227553 7:107169430-107169452 GCAGGGGGAGGGCGAAGTTCCGG + Intronic
1032283345 7:130523721-130523743 TCAGAGGAAGTGGGCTGTGCGGG + Intronic
1032284087 7:130527946-130527968 TCAGAGGAAGTGGGCTGTGCGGG + Intronic
1032285656 7:130536855-130536877 ACAGAGGAAGTGGGCTGTGCGGG + Intronic
1032286428 7:130541285-130541307 ACAGAGGAAGTGGGCTGTGCGGG + Intronic
1032519796 7:132535358-132535380 GCAGAGGAGGGGCTGTGGTCTGG + Intronic
1033989781 7:147269340-147269362 GCAGAGGGAAGGCTCAGTTCAGG + Intronic
1035530862 8:349909-349931 GCAGAGGAAGGGCCATGATGGGG + Intergenic
1035592293 8:825110-825132 GCAGAGGAAGAGCCCTCCTCTGG - Intergenic
1035658915 8:1332094-1332116 GCAAAGGAAGGTGGCTGTTGGGG - Intergenic
1036294181 8:7522019-7522041 GCAGAGGAAGGGGTCGGGTCAGG + Intergenic
1036328381 8:7798972-7798994 GCAGAGGAAGGGGTCGGGTCAGG - Intergenic
1036496606 8:9275969-9275991 GGAGAGGAAGAGAGCTGTTAAGG - Intergenic
1036664327 8:10729229-10729251 AAAAAGGAAGGGCTCTGTTCCGG + Intronic
1039414121 8:37379098-37379120 TCAGGGGAAGGGAGCTGGTCAGG - Intergenic
1042790032 8:72595138-72595160 GCACAGGAAGGGCTCTGTTAGGG - Intronic
1043438592 8:80257284-80257306 TCATAGGAAGGGCTCTGTTTTGG + Intergenic
1044627082 8:94244584-94244606 GGAGAGAAAGGGAGCCGTTCTGG - Intergenic
1048905243 8:139081624-139081646 GCACAGGAAGGGCTCTTTTGTGG - Intergenic
1048940071 8:139392858-139392880 GGAGAGGAAGGGGGCTGTGGTGG - Intergenic
1049169235 8:141148320-141148342 TCAGAGGAAGGGGGCTGAACGGG - Intronic
1049223059 8:141436606-141436628 GCAGAGGAAGGGAGCTGGGTTGG + Intergenic
1050119150 9:2290459-2290481 GCAGAAGAAGGGGGCTGCTCTGG - Intergenic
1052328777 9:27245534-27245556 GAAGAGGAAAAGCGCTGTTGAGG - Intergenic
1052357543 9:27520757-27520779 GCAGAGGAATGGCTCTCTGCAGG + Intronic
1056837605 9:89969856-89969878 GCAGAGGAAGGTGGCTGTTAGGG + Intergenic
1059699568 9:116761879-116761901 GAAGAGCAAGGGAGCTGTTGAGG + Intronic
1060247775 9:121960717-121960739 GCAGAGGCATGGCGCAGTCCGGG + Intronic
1186960893 X:14735747-14735769 GCAGAGCTAGAGCGCTGTGCTGG + Intergenic
1192233662 X:69283039-69283061 GGAGAGGAGGGGCACTGTGCAGG - Intergenic
1192236900 X:69301841-69301863 GGAGAGGAAGTGTGCTGTTCAGG - Intergenic
1195826238 X:109003972-109003994 GCAGAGGTGGAGCGCTGTGCTGG - Intergenic
1196960166 X:120992563-120992585 GCAGAGCTTGAGCGCTGTTCTGG + Intergenic
1200131534 X:153850832-153850854 GCTCAGGAAGGGGGCTTTTCCGG + Intergenic
1201932049 Y:19360945-19360967 GCAGAGCCAGTGCGCTGTGCTGG - Intergenic