ID: 998116730

View in Genome Browser
Species Human (GRCh38)
Location 5:139543491-139543513
Sequence AGGAAGGGCGCTGTTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116720_998116730 19 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116718_998116730 27 Left 998116718 5:139543441-139543463 CCTCTATACCCACGTAGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116723_998116730 8 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116717_998116730 28 Left 998116717 5:139543440-139543462 CCCTCTATACCCACGTAGATCCT 0: 1
1: 0
2: 0
3: 9
4: 60
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160
998116721_998116730 18 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116730 Original CRISPR AGGAAGGGCGCTGTTCTGGT TGG Intronic
901087798 1:6622206-6622228 TGGAAGGGCGCTGGGCTGGCGGG + Exonic
902782707 1:18715010-18715032 AGGAAGGCCGCTGGGATGGTTGG + Intronic
903379871 1:22889225-22889247 ATGAAGGGAGCTGCTCAGGTTGG + Intronic
908944270 1:69475143-69475165 GGGAAGGACCCTGTTCTGGCAGG + Intergenic
910989342 1:93038707-93038729 AGGAAGGGTACTATTCTTGTTGG + Intergenic
913351806 1:117869493-117869515 AGAAAGGGCTTTGTTGTGGTGGG - Exonic
915185918 1:154105149-154105171 AGGAAGGACACTGTCCTGGCAGG + Intronic
916876812 1:168978405-168978427 AAGAAGGGTGTTGTTTTGGTAGG - Intergenic
917619067 1:176776680-176776702 AGGCTGGGCTCTGTTCTGTTGGG + Intronic
918450828 1:184656327-184656349 AGAAAGAGAGCTGTTCTGGAGGG - Intergenic
920286160 1:204881311-204881333 AGGTAGGGCACAGTTCAGGTTGG + Intronic
920705160 1:208244859-208244881 AGGAACGGGGCTTGTCTGGTAGG + Intergenic
921820566 1:219611919-219611941 AAGAAGGGCGCTGTTTTCGACGG - Intergenic
922272111 1:224043739-224043761 AGGAAGGGGGGTGTTCTGGAGGG - Intergenic
922892321 1:229071635-229071657 AGTAAGGGCTCTGCTCTTGTAGG - Intergenic
1067099831 10:43326391-43326413 ATGCTGGGAGCTGTTCTGGTTGG + Intergenic
1068515307 10:58018457-58018479 AGGAAGGGCTTTTTTCTGCTGGG - Intergenic
1069586185 10:69604237-69604259 AGGATGGGCTCTGTTGTGGCAGG - Intergenic
1070803405 10:79256417-79256439 AGGGAGGGGGCTGCTCTGGATGG - Intronic
1073435296 10:103512649-103512671 AGGACGGGAGCTGTGCTGCTCGG + Intronic
1076582259 10:131519818-131519840 AGGAAGGGCGCCGTGCTAGCGGG - Intergenic
1076758571 10:132588598-132588620 AGGGTGGGCGCTGTGCTGGGGGG - Intronic
1077578683 11:3403186-3403208 AGAAAGAGCACTGCTCTGGTGGG - Intergenic
1080083384 11:28249025-28249047 AGGATGGTCCCTTTTCTGGTAGG - Intronic
1084320720 11:68372053-68372075 ACGAAGGAGGCTGTGCTGGTGGG + Intronic
1085205163 11:74727291-74727313 AGGAAGGGAGCTCCGCTGGTAGG - Intronic
1086208310 11:84286788-84286810 TGGAAAGGAGCTGTGCTGGTGGG + Intronic
1088563167 11:111136113-111136135 AGTAAGGACGCTGCACTGGTTGG + Intergenic
1088933217 11:114373015-114373037 AGGAAAGGTGTTGTTCTGTTCGG - Intergenic
1096608927 12:52788425-52788447 AGGAAGGTACCTTTTCTGGTTGG - Intergenic
1104573405 12:129945106-129945128 AGTAAGGCTGCTGTTCAGGTGGG - Intergenic
1105316173 13:19266132-19266154 AGGGAGGGAGCTGTTCTGAAAGG + Intergenic
1107094865 13:36525498-36525520 TGGAAGGGAGGTGTTTTGGTGGG + Intergenic
1109255245 13:60072206-60072228 AGGAAGAGGGCAGTTCAGGTAGG - Intronic
1110337424 13:74347729-74347751 AGCAAGGGCGCAGAACTGGTTGG + Intergenic
1113919435 13:113898833-113898855 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919446 13:113898887-113898909 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919457 13:113898941-113898963 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919468 13:113898995-113899017 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919479 13:113899049-113899071 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919490 13:113899103-113899125 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919501 13:113899157-113899179 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919511 13:113899211-113899233 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919521 13:113899265-113899287 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919532 13:113899319-113899341 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919543 13:113899373-113899395 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919554 13:113899427-113899449 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919565 13:113899481-113899503 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919576 13:113899535-113899557 AGGACGGCGGCTGCTCTGGTCGG - Intergenic
1113919598 13:113899643-113899665 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919608 13:113899697-113899719 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919618 13:113899751-113899773 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919629 13:113899805-113899827 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919640 13:113899859-113899881 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919651 13:113899913-113899935 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919662 13:113899967-113899989 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919673 13:113900021-113900043 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919683 13:113900075-113900097 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919704 13:113900183-113900205 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1113919757 13:113900453-113900475 AGGACGGTGGCTGCTCTGGTCGG - Intergenic
1114432178 14:22671001-22671023 GGGAAGGGCCCAGTCCTGGTAGG + Intergenic
1123030360 14:105448603-105448625 AGGACTGGGGCTGTCCTGGTCGG + Intronic
1124007603 15:25807289-25807311 AGGAAGGCCCCTGGGCTGGTGGG - Intronic
1130046270 15:80447550-80447572 AGGAAGGTCCCTGTTCAGGTTGG - Intronic
1130101243 15:80895668-80895690 ATGAATGGCTCTTTTCTGGTAGG + Intronic
1138658259 16:58502928-58502950 AGAAAGGGGGCTGTTATGCTAGG - Intronic
1144686929 17:17232249-17232271 TGGAGGGGAGCTCTTCTGGTGGG - Intronic
1144832159 17:18137830-18137852 GGGAAGGCCTCTGTTCTGGAGGG + Intronic
1146271523 17:31488490-31488512 AGGAAGGGGGCTCGTCTGCTGGG + Intronic
1146609209 17:34289670-34289692 AGGAAGGGCACTGATCTAGGAGG + Intergenic
1149515353 17:57276971-57276993 AGGAAGGGACCTGTTCTCCTTGG + Intronic
1150861670 17:68806951-68806973 AGGAAGTGCCCTGGTCTGATTGG - Intergenic
1150955961 17:69860568-69860590 AGGAAGGGCTCTTCTCTGTTTGG + Intergenic
1151559546 17:74862988-74863010 TGGGAGGGGGCTGTTCTGGGAGG - Intronic
1157820082 18:50760713-50760735 AGGGAGGGGGCAGTTCTGTTGGG - Intergenic
1164737461 19:30552418-30552440 AGGAAGGGCTCTGTTCTCAAGGG + Intronic
1166360908 19:42252666-42252688 AGGAAAGCCGCCGTTGTGGTGGG - Intronic
1166416032 19:42595533-42595555 AGAGAGAGGGCTGTTCTGGTTGG + Intronic
1167737619 19:51305933-51305955 TGGAAGAGAGCTCTTCTGGTGGG + Intergenic
926148352 2:10410770-10410792 AGCAAGGTGGCTGTTCTGCTGGG + Intronic
935618698 2:105110579-105110601 AAGAAGGGGGCTGTGCTGGGCGG + Intergenic
936075657 2:109400015-109400037 AGCAAGGGCGCTGATCTGCGGGG + Intronic
938040299 2:128070191-128070213 AGGAAGGCTGCTGTTATGGTAGG + Intergenic
938749391 2:134314362-134314384 AGGAAAGGCCCTGGCCTGGTGGG + Intronic
938775357 2:134536963-134536985 AGGAAGGGGGTTGGTCTGCTAGG + Intronic
940468641 2:154064654-154064676 AGGAAGGACCCAGTCCTGGTAGG + Intronic
942373424 2:175310714-175310736 AGGAAAGGAGCTGAGCTGGTTGG + Intergenic
946711440 2:222511174-222511196 AGCATGGGCTCTGTTCTGGATGG - Intronic
947535043 2:230934883-230934905 AGGAAGGGCATTGTCCTGTTGGG + Intronic
948825221 2:240570691-240570713 AGGAAGAACGCTGTTCTTGCTGG - Intronic
948829813 2:240593125-240593147 AGTGAGGGCGCTGGTCTGGTGGG + Intronic
1169111455 20:3036889-3036911 AGCAATGGCTCTGTGCTGGTGGG + Intronic
1171451547 20:25239455-25239477 AGGAAGGGTCCTTTGCTGGTGGG + Intergenic
1172919848 20:38472447-38472469 AGGAAGAGTGCTGTAATGGTGGG + Intergenic
1173229074 20:41180176-41180198 AGGAAGGCAGCCGCTCTGGTGGG - Exonic
1174729594 20:52902830-52902852 GGGAACTGTGCTGTTCTGGTTGG - Intergenic
1174908139 20:54574136-54574158 AGGAAGGACGCTGTGCTGCCTGG + Intronic
1175405500 20:58723392-58723414 AGGCAGGGAGCTGGGCTGGTTGG - Intergenic
1179058114 21:37954697-37954719 TGGAAGGGAGCTCTTCTGATGGG - Intronic
953138661 3:40206574-40206596 AGGAAGGGCCCTCATCTGGTTGG - Intronic
953637290 3:44674017-44674039 AAGAAGGACGCTGTTCTAGGAGG - Intergenic
955651275 3:61196789-61196811 AGGAAGGCCACAGTTCCGGTTGG - Intronic
961302789 3:125933095-125933117 AGAAAGAGCACTGCTCTGGTGGG + Intronic
962893133 3:139690512-139690534 AGGAAGGGCTGTTTTCTGGGAGG + Intergenic
964656007 3:159066813-159066835 AGGAATAGAGCTGTTCTTGTGGG + Intronic
968393691 4:213560-213582 AGGAAGAGCGCTGAGCTTGTGGG + Intergenic
968994468 4:3936879-3936901 AGAAAGAGCACTGCTCTGGTGGG - Intergenic
969175486 4:5395843-5395865 AGGAAAGGGGCTGTTCTGTTTGG - Intronic
969819469 4:9709357-9709379 AGAAAGAGCACTGCTCTGGTGGG + Intergenic
969839188 4:9868162-9868184 AGAAAGCGGTCTGTTCTGGTGGG + Intronic
969924696 4:10575011-10575033 AGGAAGGGCTCTATTCTGCCAGG - Intronic
974572774 4:63675798-63675820 AGGTAGGGCTCTGTACTAGTTGG + Intergenic
984924769 4:184797050-184797072 AGGAAGGGAGCTGTCCAGGAAGG - Intronic
985979144 5:3448142-3448164 AGGAAGGCAGCTGTGCTGATGGG - Intergenic
986579749 5:9252939-9252961 AGGAAGAGCTGTGTTCTGGTAGG - Intronic
987337188 5:16907161-16907183 AGAAATGGCGATGTTCTTGTGGG - Intronic
989463846 5:41731225-41731247 AGGAAGGGGGATGTTCTAGGGGG + Exonic
991256818 5:64622961-64622983 AGGAAGGGCGCTGGAATGCTCGG - Intergenic
992409565 5:76492207-76492229 AGGAAGGTTGCTGTGCTGCTAGG + Intronic
995314984 5:110759569-110759591 AGAAAGGAAGCTGTTATGGTTGG + Intronic
998116730 5:139543491-139543513 AGGAAGGGCGCTGTTCTGGTTGG + Intronic
998721656 5:144958612-144958634 AGCAAGGGGGCTGTTCTGGGTGG + Intergenic
999641642 5:153678789-153678811 AGGAAGGACTCTGTACTGGGAGG + Intronic
1002329924 5:178434367-178434389 TGCAGGGGCGCTGTCCTGGTGGG - Intronic
1005876142 6:30011162-30011184 AGGAAGGTGGCTGTTGTGCTGGG + Intergenic
1007751481 6:44074269-44074291 AGGCAGGGAGCTGGTCTGTTTGG - Intergenic
1009565071 6:65302643-65302665 AAGAAGGGCGCTGTTTTCGACGG + Intronic
1009598022 6:65761339-65761361 AGGATGTGCACTGTTCTAGTCGG + Intergenic
1012824145 6:104126238-104126260 GGGAAGGGCCCAGTCCTGGTGGG - Intergenic
1012827313 6:104162752-104162774 AGGAAGGACCCAGTTCTGGCAGG + Intergenic
1013923768 6:115442764-115442786 AGAAAAGGCACTGTTATGGTGGG - Intergenic
1019177567 6:170167959-170167981 AGGAGGGGACCTGTTCTGGCTGG + Intergenic
1024239807 7:47425544-47425566 AGGCAAGGGGCTGTGCTGGTGGG + Intronic
1024259135 7:47560733-47560755 AGAAAGGACACTGTTCTGGGTGG - Intronic
1026279700 7:68911262-68911284 AAGAAGCTCACTGTTCTGGTTGG + Intergenic
1032519797 7:132535362-132535384 AGGAGGGGCTGTGGTCTGGTTGG + Intronic
1033277850 7:139986047-139986069 AGGTGGGCCGCTGTTCCGGTGGG - Intronic
1034466243 7:151231644-151231666 AGGGAGGGTGCCATTCTGGTTGG + Intergenic
1035055212 7:156030763-156030785 GGGATCGGCGCTGGTCTGGTGGG + Intergenic
1035534368 8:379850-379872 AGGAAGGGCGTTGCTTTGGCAGG - Intergenic
1035676917 8:1462546-1462568 GAGAAGGGCGGTGTTCAGGTTGG + Intergenic
1035677197 8:1464145-1464167 TGGAAGGGAGCTGTCCTGGATGG - Intergenic
1035677205 8:1464177-1464199 TGGAAGGGAGCTGTCCTGGACGG - Intergenic
1035677232 8:1464273-1464295 TGGAAGGGCGTTGTCCTGGAAGG - Intergenic
1035677241 8:1464305-1464327 TGGAAGGGCGTTGTCCTGGAAGG - Intergenic
1035677255 8:1464353-1464375 TGGAAGGGCGTTGTCCTGGAAGG - Intergenic
1035677285 8:1464479-1464501 TGGAAGGGAGCTGTCCTGGAAGG - Intergenic
1035725554 8:1823433-1823455 GGGAGGGGCGATGTTCTGGGGGG + Intergenic
1043454578 8:80400811-80400833 AGGAAGGAGGCTGTTCTTTTTGG - Intergenic
1048904434 8:139074301-139074323 AGGAGGGGCGCTGTGCTTGCTGG - Intergenic
1049825257 8:144663573-144663595 AGGAAGGAGGCTGCTGTGGTTGG - Intergenic
1050508192 9:6368998-6369020 GGGAAGGGCCCAGTTCTGGCAGG + Intergenic
1052661901 9:31444116-31444138 AGGAAGGGCTTTGTTCAGCTGGG - Intergenic
1055387722 9:75781198-75781220 AGTAAGGGAGCAGTTCTTGTGGG - Intergenic
1055610786 9:78021923-78021945 AGGAAGGGCGATATCCTGGGAGG - Intronic
1055706312 9:79008696-79008718 AGGAAGGGCTTTATTCTGCTGGG - Intergenic
1055968734 9:81890296-81890318 AGGAAGGGAGCTACTCTGGTAGG - Intergenic
1059439835 9:114300840-114300862 AGGATGGGGGCTGAGCTGGTGGG - Intronic
1059822395 9:117987911-117987933 AGGAAGAGCTCTTTTCTGTTTGG + Intergenic
1062269811 9:135703233-135703255 AGAAAGGGCTCTGTCCTGGTGGG - Intronic
1186269308 X:7867497-7867519 ACAAAGGGAGCTGTTCTAGTTGG - Intergenic
1186279945 X:7981288-7981310 AAGAAGGGCACCATTCTGGTGGG - Intergenic
1186395784 X:9207468-9207490 TGGAAGGGCTCTGTTCTCTTTGG - Intergenic
1187266505 X:17738307-17738329 AGGAAAGGCCCTGATTTGGTTGG + Intronic
1195383374 X:104291439-104291461 TGGAAGGGGGCTCTTCTGATGGG - Intergenic
1197037375 X:121890558-121890580 AGTATGGTCTCTGTTCTGGTTGG - Intergenic
1197439307 X:126470852-126470874 AGGAAGGACGCAGTCCTGGCAGG + Intergenic
1197669086 X:129255934-129255956 AGGAAGGGGACTGCTCTTGTAGG - Intergenic
1201623634 Y:15988443-15988465 AGGAAGCACGCTGTGCTAGTGGG - Intergenic
1201854602 Y:18527632-18527654 AGGAAGGGCGGAGGTCGGGTAGG + Intergenic
1201878719 Y:18792753-18792775 AGGAAGGGCGGAGGTCGGGTAGG - Intronic