ID: 998116731

View in Genome Browser
Species Human (GRCh38)
Location 5:139543497-139543519
Sequence GGCGCTGTTCTGGTTGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116723_998116731 14 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
998116720_998116731 25 Left 998116720 5:139543449-139543471 CCCACGTAGATCCTGGATTGCAC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
998116721_998116731 24 Left 998116721 5:139543450-139543472 CCACGTAGATCCTGGATTGCACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116731 Original CRISPR GGCGCTGTTCTGGTTGGTCC TGG Intronic
900181676 1:1313816-1313838 GCGGATCTTCTGGTTGGTCCAGG + Exonic
901626364 1:10627382-10627404 GACCCTGTTCTGGTCGGGCCTGG + Intronic
901759058 1:11458995-11459017 GGCGCTGGGCTGTTCGGTCCTGG + Intergenic
903009952 1:20322655-20322677 GGTGCTGCTGTTGTTGGTCCTGG - Intronic
906192939 1:43910271-43910293 GCAGCTGTGCTGGCTGGTCCAGG - Intronic
907498203 1:54859305-54859327 GTGGCTGATCTGGGTGGTCCTGG - Intronic
908417562 1:63928248-63928270 GGCCCTTTTCTTGTTGCTCCTGG + Intronic
918074857 1:181162172-181162194 GGTGCTGGTCTGATAGGTCCCGG - Intergenic
923000972 1:230006153-230006175 GGAGCTGTCCTGGTTGGACTAGG + Intergenic
923766855 1:236900512-236900534 GCAGCTGTTCTGGTTCCTCCTGG + Exonic
1067099833 10:43326397-43326419 GGAGCTGTTCTGGTTGGGTTTGG + Intergenic
1070355595 10:75637245-75637267 AGTTCTGTTCTGATTGGTCCAGG + Intronic
1070827848 10:79401590-79401612 GCCGCTGTTCTCATGGGTCCTGG + Intronic
1072806969 10:98429851-98429873 GGGGATGTTCTGGCTGCTCCGGG + Exonic
1077582884 11:3428301-3428323 GAGGCTGTTCTGGCTGCTCCTGG + Intergenic
1078902710 11:15656224-15656246 GGCCCTGTTCTTCCTGGTCCTGG - Intergenic
1081595638 11:44457437-44457459 ATAGCTGTTCTGGTTTGTCCAGG - Intergenic
1081934591 11:46896089-46896111 GGAGCTGTTCTTTGTGGTCCAGG - Intronic
1083068344 11:59949154-59949176 GGCTTAGTTGTGGTTGGTCCTGG + Intergenic
1084274233 11:68043508-68043530 GGCGCTGGGCTGGGGGGTCCTGG + Intronic
1090496787 11:127220920-127220942 TGCCTTTTTCTGGTTGGTCCTGG - Intergenic
1092084197 12:5742219-5742241 GGTGCTGTGCTGGGTGGGCCTGG - Intronic
1094045330 12:26160146-26160168 GGCACTGCACTGTTTGGTCCAGG + Intronic
1102143637 12:110637597-110637619 GGAGCTGTGCTGGTTGGAGCAGG + Intronic
1103506308 12:121443960-121443982 GGGGTTGGTCTGGCTGGTCCCGG - Intronic
1105451437 13:20503425-20503447 GGTGCTGTGCTGGATGGTGCTGG + Intronic
1113408767 13:110065396-110065418 GGGGTCGTTCTGGATGGTCCAGG - Intergenic
1113878790 13:113610837-113610859 GGCGTTCTCCTGGTTGTTCCTGG + Intronic
1121301549 14:92875526-92875548 GGCCCTGTCCTGGGTGCTCCAGG + Intergenic
1122808908 14:104278074-104278096 GGTGCTCTTCAGGTTGGTGCTGG - Intergenic
1123778659 15:23604527-23604549 GGCACTGGTGTGGTTTGTCCAGG - Intronic
1124115710 15:26841886-26841908 GGGGCTGTTCTGGTTTTTCTAGG - Intronic
1124377056 15:29135023-29135045 GGTGCAGTTCTGGGTGGGCCTGG + Intronic
1125999378 15:44194944-44194966 GGCGCTGACCTGGATGGTGCAGG + Exonic
1129082158 15:73051637-73051659 GGCGCGGTTCGGGCGGGTCCCGG + Intergenic
1129302370 15:74632828-74632850 TGCCCGGTTCTGGTTGGCCCAGG + Exonic
1132150459 15:99454867-99454889 GGCTCGCTTCTGGTGGGTCCTGG - Intergenic
1132652296 16:1027002-1027024 GCCGCTGTCCTGGGCGGTCCTGG - Intergenic
1135277763 16:21128184-21128206 GAAGATGTTCTGCTTGGTCCTGG - Intronic
1135481076 16:22821065-22821087 GGCTCTCTTCTGATTGGTCCGGG + Intronic
1140896819 16:79331895-79331917 GCCACTGTACTGGTTGGTCAGGG - Intergenic
1142715484 17:1744998-1745020 GGCGCTGCTCTGGGGGCTCCTGG + Exonic
1142964697 17:3573297-3573319 GGCTGTGGTCTGGGTGGTCCTGG - Intronic
1143091230 17:4450118-4450140 GACCCTGTCCTGGTGGGTCCTGG + Intronic
1146656853 17:34639591-34639613 GGCTCTGTTCTGATTGGCTCAGG + Intergenic
1150813506 17:68375199-68375221 GACGCTGATGTGGTTGGTCCAGG + Intronic
1151752918 17:76051790-76051812 GGTGCTGCTCTGGTGGTTCCAGG - Intronic
1156200767 18:34829118-34829140 TGAGCTGTTCTGGTTCCTCCAGG + Intronic
1157282050 18:46352597-46352619 GGCCCTTTTCTGCATGGTCCAGG + Intronic
1157811244 18:50697740-50697762 GGCTCTGTACTGGTAGGCCCAGG - Intronic
1159637875 18:70827429-70827451 GGCGGTGCTCTGGTTGGTTGTGG + Intergenic
1161031264 19:2058752-2058774 GGCCCTGTGCTGGGTGGTCGGGG - Intergenic
1161468752 19:4446147-4446169 GGCGGTGTACGGGTTCGTCCGGG - Exonic
1165248689 19:34513194-34513216 GGCTCTGATCTGCTTTGTCCTGG + Intergenic
1167124383 19:47539200-47539222 GGCCCTGTGCTGGGTGGTGCTGG - Intronic
926914296 2:17878357-17878379 GGCGCTGTCCGGGTGGGACCAGG - Intronic
927189326 2:20506347-20506369 GGTGCTGGTAAGGTTGGTCCTGG - Intergenic
942891736 2:180998255-180998277 GGTGGTGTTCTGGTTGGACTTGG + Intronic
1169163833 20:3406568-3406590 GGTGCTGATCTTGTTGGTCTGGG - Intronic
1171109201 20:22464909-22464931 GGCGCTGTTCTGTTGTCTCCTGG - Intergenic
1172693275 20:36804833-36804855 GGAGCTGTGCTGGCTGCTCCGGG - Exonic
1173026421 20:39311313-39311335 GGCTTTCTTCTGGTTGGCCCAGG - Intergenic
1178403805 21:32308789-32308811 GGGGCTGCACTGATTGGTCCAGG + Intronic
1181553332 22:23653383-23653405 GGCACTGTTCTGGATGGTGGAGG - Intergenic
1183209431 22:36441718-36441740 GACTCTGTTCTGGTTGGGCTTGG + Intergenic
1183933430 22:41248787-41248809 GGCCTTGTTCTGGAGGGTCCTGG - Intronic
953429745 3:42829449-42829471 GGGGCAATTCTGGTTGGCCCAGG + Intronic
953637289 3:44674011-44674033 GACGCTGTTCTAGGAGGTCCAGG - Intergenic
954692263 3:52401866-52401888 GGAGCTGTCCTGGTGGGCCCAGG - Exonic
962412478 3:135153260-135153282 GGGGCTGTTCCGTTTAGTCCTGG - Intronic
969815810 4:9686646-9686668 GAGGTTGTTCTGGTTGCTCCTGG - Intergenic
980917254 4:139045197-139045219 GGCGCTGTTCAGGTTGAGGCTGG - Exonic
996743825 5:126827967-126827989 GGGCCTGTTCTGGTAGATCCTGG + Intronic
998116731 5:139543497-139543519 GGCGCTGTTCTGGTTGGTCCTGG + Intronic
1008554845 6:52664579-52664601 GCCGCCGTTCTGGTTGGCCTTGG - Intergenic
1014706931 6:124759152-124759174 GGCCCTGTTCTGGTGGCTGCAGG - Intronic
1018071601 6:160168646-160168668 GGCGCTGTTCTGTGCGTTCCTGG + Intergenic
1019914199 7:4122043-4122065 GTCTCTCTTCTGGTTGGTGCTGG + Intronic
1023516612 7:41008202-41008224 GGCACTGTTCTGATTCTTCCTGG + Intergenic
1030074056 7:105721399-105721421 GCCGCTGTGCTGAATGGTCCAGG - Intronic
1032469748 7:132169729-132169751 GGCCATGTTCTGCTTGGTGCTGG + Intronic
1034345866 7:150384784-150384806 GGAGCTGCTCTGGGAGGTCCCGG + Intronic
1040386545 8:46918256-46918278 TGCGCTGGCCTGGGTGGTCCAGG - Intergenic
1041191375 8:55358836-55358858 AGTTTTGTTCTGGTTGGTCCGGG + Intronic
1044499228 8:92931778-92931800 AGGGCTGTCCTGGATGGTCCTGG - Intronic
1053261912 9:36674165-36674187 GGCACTGTTTTAGTGGGTCCTGG - Intronic
1058830475 9:108811898-108811920 GGCCCTGATCTGGCTGCTCCAGG + Intergenic
1059016219 9:110518905-110518927 GGGGCTTATCTGGTTGGTACAGG - Intronic
1060477462 9:123997264-123997286 GGCGCTGTGGAGGTTGGCCCAGG + Intergenic
1200690986 Y:6306270-6306292 GGCCCGGTTCTGCTGGGTCCAGG - Intergenic
1201044286 Y:9868446-9868468 GGCCCGGTTCTGCTGGGTCCAGG + Intergenic