ID: 998116732

View in Genome Browser
Species Human (GRCh38)
Location 5:139543511-139543533
Sequence TGGTCCTGGCCTTACCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998116723_998116732 28 Left 998116723 5:139543460-139543482 CCTGGATTGCACGTCAGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 998116732 5:139543511-139543533 TGGTCCTGGCCTTACCCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998116732 Original CRISPR TGGTCCTGGCCTTACCCCGC CGG Intronic
901118897 1:6874254-6874276 TGGTCCTGGCCTTTCACCACGGG - Intronic
901195504 1:7437768-7437790 TGGCCCGGGACTTACCCCACAGG - Intronic
902873141 1:19326154-19326176 AAGTCCTGGCCTTGCCCCTCAGG - Intronic
904885349 1:33733589-33733611 TGGTCCTGCCCTTGACACGCAGG - Intronic
910758915 1:90717075-90717097 CGGTCCTGGCCTCACCGAGCGGG + Exonic
912489002 1:110050934-110050956 TGTTCCTGGGTTTACCCTGCAGG + Exonic
912546890 1:110457418-110457440 TGGTCCTTGCCTTCCTCCCCAGG - Intergenic
915283920 1:154841020-154841042 AGGTCGGGGCCTGACCCCGCAGG - Intronic
918936552 1:190929347-190929369 TGGTCCTGGACTCACACCGTTGG - Intergenic
919724398 1:200872797-200872819 TGTCCCTGCCCTTACCCCTCGGG + Intergenic
922056732 1:222049382-222049404 GGGCCTTGGCCTTACCCTGCAGG - Intergenic
922334446 1:224607323-224607345 TGGTCCTTGCCTTTCCCAGAGGG + Intronic
1063130232 10:3172101-3172123 TCGGCCTGGCCTTACCGCTCAGG - Intronic
1064280424 10:13946277-13946299 TGGTTCTAGCCTTAGCCCTCAGG - Intronic
1067081795 10:43216410-43216432 GGGTCCTCACCTTACCCTGCGGG + Intronic
1067473218 10:46550565-46550587 TGGTGCTGGCCTCGCCCAGCTGG + Exonic
1069837623 10:71319261-71319283 TGGTCCTGGCCGTGCGCCGGAGG + Exonic
1070823234 10:79375479-79375501 TGGTCCTGGACTTACAAGGCAGG + Intergenic
1076120433 10:127932735-127932757 TGGGCCTGGCCTGGCCCAGCTGG + Intronic
1084154697 11:67307059-67307081 TGGGCCTGGTCTTGCCCCTCTGG + Exonic
1090114936 11:123959191-123959213 TGGTCCTGGCTTTTCCCAGTTGG + Intergenic
1091666182 12:2420032-2420054 TGGCCATGGCCTCACCCCTCTGG + Intronic
1092731024 12:11534834-11534856 GGGTCCTGGGCTCACACCGCTGG + Intergenic
1108438061 13:50420806-50420828 TGGTGCTGTCCTCACCCCACAGG + Intronic
1115780109 14:36759590-36759612 TGATCCTGGCCTTTCCCCTTTGG - Intronic
1116688649 14:48076417-48076439 TGGTCCTGGCATTTCCCCAAAGG + Intergenic
1118818790 14:69331331-69331353 TGGCCCTGGGCATACCCTGCAGG + Intronic
1121427216 14:93860967-93860989 TGTTCCTGGCCTTCCCCTGGAGG - Intergenic
1122094995 14:99364079-99364101 TCGTCCTGGCCTGACCCAGGAGG - Intergenic
1125386244 15:39140060-39140082 TGGTCCTGACCTTACCCTCCTGG - Intergenic
1129111550 15:73340085-73340107 TGGTCCTGGCCTTTCTCTGGGGG - Intronic
1134121156 16:11586227-11586249 GGGTGCCCGCCTTACCCCGCGGG + Intronic
1139370674 16:66467538-66467560 TGGTCCTGCCCTTAACACGTGGG + Intronic
1148972002 17:51491626-51491648 TGGTCCTGGCCCCACCCCAGGGG - Intergenic
1149461568 17:56833820-56833842 TCCTCGTGGCCTTGCCCCGCCGG + Exonic
1160180832 18:76634867-76634889 TGGACCTGTCCTTACCCTACGGG + Intergenic
1160334903 18:78030211-78030233 TTGTCCTGGCCCCACCCCTCTGG + Intergenic
1162514222 19:11138559-11138581 TGGTCCTGTCCTGTCTCCGCAGG + Intronic
1163177784 19:15576543-15576565 TCTTCCTGGCCTGACCCTGCGGG + Intergenic
1163366400 19:16878231-16878253 AGCTCCTGGCCTCACCGCGCAGG - Exonic
1164463616 19:28469260-28469282 TGTTCCTGGCCTGGCCCCGTGGG - Intergenic
1166046339 19:40233055-40233077 TGGGCCTGGCCTGGCCCCACTGG - Exonic
1167428057 19:49439748-49439770 TGGTCCTGGCCAGAGCCCGGGGG + Intronic
1168707227 19:58477085-58477107 TGGTCCTGGTCTCAGCCCCCTGG + Intronic
925031135 2:650474-650496 CAGTCCTGGCCTTACCCCGCTGG - Intergenic
927025591 2:19065490-19065512 TGGTCCTGCCCTTGGCACGCGGG + Intergenic
927203490 2:20592695-20592717 AGTTCCTGGCGTTCCCCCGCTGG + Intronic
927786902 2:25980909-25980931 TGGTCTTGGCATTCCCCCCCAGG + Exonic
937952976 2:127402407-127402429 CGCTCCTGGCCTTACCAGGCTGG + Intergenic
939677094 2:145085942-145085964 TGTTCCTGGCCTTAACTCCCTGG + Intergenic
943720036 2:191194316-191194338 TGGGCCTTGCCTTACCACACAGG + Intergenic
945912040 2:215660692-215660714 TGGTCCAGACCTTCCCCAGCAGG - Intergenic
948844555 2:240676890-240676912 TGGTCCTGGTCTTCCCGCCCTGG + Intronic
948849305 2:240697989-240698011 TGGTCCTGGTCTTCCCGCCCTGG - Intronic
1176080964 20:63272876-63272898 CGGCCCTGGCCTGACCCCGGCGG + Exonic
1180006042 21:45021173-45021195 TGATCCTGGCCATACTCCCCTGG + Intergenic
1184821236 22:46910569-46910591 TGGGCCTGGCCTTAGCTGGCAGG + Intronic
1184857047 22:47151994-47152016 TGGTCTGGGCCTTACTCTGCTGG + Intronic
1185029151 22:48432488-48432510 TGGTCCTGGCCCTTCCCAGGAGG + Intergenic
949865243 3:8541914-8541936 TGATCCTGGCCTTGCCTGGCTGG - Intronic
950453418 3:13078500-13078522 GGCTCCTGGCCTTCCCCCCCAGG - Intergenic
961372856 3:126441822-126441844 TGGTCCTGGCCGTCCTCCGCTGG + Exonic
962710010 3:138078268-138078290 TGGTCCTGGTCTTACCACAGAGG - Intronic
964756878 3:160096786-160096808 ATGTCCTGGCCTTACCCACCTGG + Intergenic
966883703 3:184363052-184363074 GGGCCCTAGCCCTACCCCGCCGG - Intronic
968528014 4:1074353-1074375 GGCTCCTTGCCTCACCCCGCTGG + Intronic
977399317 4:96511268-96511290 TGGCCTTGGACTTACCCCTCAGG - Intergenic
983254097 4:165379140-165379162 CGGCCCTGGGCTTAGCCCGCCGG - Exonic
990094415 5:52094300-52094322 TGGTCCTGCCCTTACCACGTGGG - Intergenic
998116732 5:139543511-139543533 TGGTCCTGGCCTTACCCCGCCGG + Intronic
1002167502 5:177357647-177357669 TGGTCCTGGCCAGACCAGGCTGG + Intergenic
1003567901 6:7236116-7236138 TGTTCCTGCCTTTACCCCTCGGG + Intronic
1012297549 6:97544014-97544036 TGGTCCTGGGCTTTCCTTGCTGG + Intergenic
1013512624 6:110858616-110858638 TAGTCCTGGCCTTACTCACCAGG - Intronic
1013743991 6:113322883-113322905 TGCTCCTGTCCTTACCCCAGAGG + Intergenic
1015970971 6:138742063-138742085 AGGTCCTGACCATACCCTGCTGG + Intergenic
1018669422 6:166167106-166167128 TGGTCCCCGCCTGTCCCCGCGGG - Intronic
1019164474 6:170088842-170088864 TGGCCCTGGACTGTCCCCGCCGG + Intergenic
1019171918 6:170137517-170137539 TGGGCCTGGCCTTGTCTCGCCGG - Intergenic
1026987176 7:74561941-74561963 TGGTCGTGGCCTCAGCCCTCAGG + Intronic
1031956178 7:127944750-127944772 TGGTCTTGGTCTTACCTCCCTGG - Intronic
1032084614 7:128877402-128877424 TGGTCCTGCCCTGAGCCCTCCGG + Intronic
1038972198 8:32648057-32648079 GGGTCCTGGCCTAACCCCCCAGG - Intronic
1039118739 8:34121986-34122008 TGGTCCTGGCCCTTCCCTGCAGG - Intergenic
1040379811 8:46861447-46861469 TGGTCCTGGACTTGCCCCTTGGG - Intergenic
1045254667 8:100509519-100509541 TGGCCCTGGTCTTTCCCAGCAGG + Intergenic
1049050051 8:140187659-140187681 TCGTCCTGGCCTTTCCCTGTTGG + Intronic
1049646219 8:143736978-143737000 TGGGCCTGGCCTAACACCCCTGG + Intergenic
1056572765 9:87830359-87830381 TTGTCCTGCCCATACCCAGCAGG + Intergenic
1062370280 9:136235250-136235272 TGGTCCTGGCCCTCCTCCGGGGG - Intronic
1062398548 9:136362544-136362566 TGGTCCGGGCCTTGCCTGGCCGG - Intronic
1185445515 X:255932-255954 TTGTTCTGGCCTTACTCTGCCGG + Intergenic
1200284181 X:154805114-154805136 TGGCCTTGTCCTCACCCCGCCGG + Intronic
1200370562 X:155720069-155720091 TGGTCTGGGACTTACCCTGCAGG - Intergenic
1202152319 Y:21854952-21854974 TGGTCTTGGTCTTACCTCCCAGG + Intergenic