ID: 998123462

View in Genome Browser
Species Human (GRCh38)
Location 5:139598952-139598974
Sequence AAGTCTCGTTCTGTTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 4, 3: 112, 4: 759}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998123460_998123462 27 Left 998123460 5:139598902-139598924 CCTTTTAAAATATATTCCTTTTT 0: 1
1: 6
2: 21
3: 271
4: 2053
Right 998123462 5:139598952-139598974 AAGTCTCGTTCTGTTGTCCCAGG 0: 1
1: 0
2: 4
3: 112
4: 759
998123461_998123462 11 Left 998123461 5:139598918-139598940 CCTTTTTTTTTTTTTTTTTTTTT 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
Right 998123462 5:139598952-139598974 AAGTCTCGTTCTGTTGTCCCAGG 0: 1
1: 0
2: 4
3: 112
4: 759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998123462 Original CRISPR AAGTCTCGTTCTGTTGTCCC AGG Intronic
900292768 1:1930580-1930602 GAGTCTCGCTCTGTTGCCCTAGG + Intronic
901415268 1:9112059-9112081 GAGTCACGTCCTGCTGTCCCAGG + Intronic
901415454 1:9113148-9113170 GAGTCACGTCCTGCTGTCCCAGG + Intronic
901718146 1:11173315-11173337 AGGTCTGGTTCTGTTATCCAAGG + Intronic
901812842 1:11777617-11777639 GATTCTCGCTCTGTTGTCCAGGG - Intronic
902026155 1:13385198-13385220 GAGTCTCGCTCTGTGGTCCCGGG - Intergenic
902367771 1:15988767-15988789 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
902416127 1:16240636-16240658 AAGTCTCGCTCTTGTGCCCCAGG + Intergenic
902847506 1:19123423-19123445 AAGTCTCACTCTGTTGACCCAGG - Intronic
902892697 1:19455938-19455960 AAGTCTCACTCTGTTGCCCAGGG + Intronic
902915662 1:19637621-19637643 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
903032780 1:20475648-20475670 AAGTCTCGCTCTTGTGCCCCAGG - Intergenic
903095700 1:20970936-20970958 AAGTCTCGCTCTTTTCCCCCAGG - Intronic
903356378 1:22750393-22750415 AAGTCTGGCTCTGGTGACCCAGG - Intronic
903806630 1:26010418-26010440 GAGTCTCGTTCTGTTGCCCCAGG + Intergenic
903902643 1:26659266-26659288 CAGTCTCGCTCTGTTGCCCAGGG + Intergenic
903937478 1:26906421-26906443 CAGTCTCATTCTGTTGCCCAGGG - Intronic
904539180 1:31221310-31221332 AATTCTCATTGTGTGGTCCCTGG + Intronic
904642646 1:31941931-31941953 GAGTCTCGATCTGTTGCCCAGGG - Intronic
904648227 1:31984511-31984533 AAGTCTCGTTCTTGTCGCCCAGG - Intergenic
904679629 1:32220199-32220221 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
905295150 1:36949598-36949620 GAGTCTCGCTCTGTTGCCCCAGG + Intronic
905690569 1:39939693-39939715 AAATCTCCTTATGTTGTCCTGGG - Intergenic
906394554 1:45450483-45450505 GAGTCTCGTTTTGTTGCCCAGGG - Intronic
906437066 1:45805074-45805096 AAGTCTCGCTCTGTCGCCCAGGG + Intronic
906437699 1:45811190-45811212 AAGTCTCGCTCTTGTCTCCCAGG + Intronic
906540072 1:46578611-46578633 GAGTCTCCCTCTGTTGTCCAGGG + Intronic
906623044 1:47300492-47300514 GAGTCTCGTTCTTTTTGCCCAGG + Intronic
907101299 1:51839184-51839206 AAGTCTCACTCTGTTGGCCAGGG + Intronic
907202701 1:52741270-52741292 AAGTCTCACTCTTTTGCCCCAGG - Intronic
908112811 1:60914090-60914112 AGGTCTCACTCTGTTGTCCAGGG + Intronic
908406921 1:63823785-63823807 AAGTCTCGATCTGTCGCCCAGGG + Intronic
908743691 1:67355087-67355109 ATGTCTTGTTCTGTTGCCCAGGG - Intronic
908763007 1:67529631-67529653 AAGTCTCGTTCTTGTCCCCCAGG + Intergenic
909148616 1:71970659-71970681 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
909495865 1:76278245-76278267 GAGTCTCGCTCTGTCATCCCAGG + Intronic
909631749 1:77775374-77775396 AAGTCTCGCTCTGTTGCCCAGGG - Intergenic
910303702 1:85737587-85737609 GAGTCTCATTCTGTTAGCCCAGG + Intronic
911049867 1:93661511-93661533 AAGTTTCGCTCTGTTGCCCCAGG + Intronic
911219028 1:95227902-95227924 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
911327839 1:96490017-96490039 CAGTCTCACTCTGTTGCCCCGGG - Intergenic
911542068 1:99169226-99169248 AAGTCTCACTCTGTTACCCCAGG + Intergenic
912676570 1:111687232-111687254 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
912820721 1:112865630-112865652 AAGTCTCGCTCTTATCTCCCAGG + Intergenic
913568535 1:120097649-120097671 AAGTCTCACTCTGTTGCCCCAGG + Intergenic
913590733 1:120322365-120322387 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
913617508 1:120576291-120576313 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
914289348 1:146258670-146258692 AAGTCTCACTCTGTTGCCCCAGG + Intergenic
914550384 1:148709423-148709445 AAGTCTCACTCTGTTGCCCCAGG + Intergenic
914572764 1:148934628-148934650 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
914600079 1:149195577-149195599 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
914890277 1:151615565-151615587 AAGTTTACCTCTGTTGTCCCAGG + Intronic
914911136 1:151787957-151787979 AATTCTCGCTCTGTTGCCCAGGG - Intronic
915077767 1:153324837-153324859 AAGTCTCACTCTGTTGCCCAGGG - Intergenic
915130421 1:153691858-153691880 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
915385693 1:155489993-155490015 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
915534311 1:156525851-156525873 AAGTCTTGTTCTCTTGTCTGTGG - Exonic
915742437 1:158129320-158129342 AAGTCTCGTTCTTCTCCCCCAGG + Intergenic
916085506 1:161266204-161266226 ATTTATCGTTCTGTTGTCCTTGG + Intronic
916294984 1:163208486-163208508 GAGTCTTGTTCTGTTGCCCAGGG - Intronic
916742732 1:167660664-167660686 GAGTCTCATTTTGTTGTCCAGGG + Intronic
916896468 1:169168445-169168467 AAGTCTCGCTATGATGTCCAGGG + Intronic
917204323 1:172554709-172554731 GAGTCTCACTCTGTTGCCCCAGG - Intronic
917309859 1:173667678-173667700 GGGTCTCATTCTGTTGTGCCAGG - Intronic
917467584 1:175295830-175295852 AAGTCTCGTTCTTGTCCCCCAGG + Intergenic
917960068 1:180135212-180135234 AAGTCTTGCTATGTTGTCCAGGG - Intergenic
918499609 1:185179240-185179262 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
919898820 1:202028321-202028343 AAGTCTCGCTCTTTTCCCCCAGG - Intergenic
920919600 1:210287582-210287604 AAGTCTCGCTCTTGTCTCCCAGG - Intergenic
921370039 1:214413067-214413089 GAGTCTCGTTTTGTTGCCCAGGG + Intronic
921502660 1:215924791-215924813 AAGTCTCTCTCTCTTGCCCCAGG + Intronic
921649014 1:217654741-217654763 GAGTCTCGCTCTGTCGTCCCAGG + Intronic
922479613 1:225930230-225930252 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
922676525 1:227556079-227556101 CAGTCTTTTTCTGTGGTCCCAGG - Intergenic
922830902 1:228553627-228553649 AAGTCTCGCTCTTGTCTCCCAGG - Intergenic
923576680 1:235164691-235164713 GAGTCTCACTCTGTTGCCCCAGG - Intronic
923715303 1:236420157-236420179 AAGTCTCACTTTGTTGTCCAGGG - Intronic
1062766904 10:73237-73259 AGGTCTCGCTCTGTTGCCCAGGG + Intergenic
1062835766 10:634723-634745 GAGTCTCGTTCTTTTTGCCCAGG - Intronic
1063195718 10:3741096-3741118 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
1063418488 10:5891634-5891656 GAGTCTCGCTCTGTTGCTCCGGG + Intronic
1064002146 10:11672731-11672753 GAGTCTCGCTCTGTCGTCCAGGG + Intergenic
1064379625 10:14829653-14829675 AAGTCTCGCTCTGTTCACCCAGG + Intronic
1064655931 10:17556090-17556112 AGGTCTTGCTCTGTTGTCCAGGG - Intergenic
1064698320 10:17989882-17989904 GAGTCTCGTTCTGTTGCCCAGGG - Intronic
1065011271 10:21422975-21422997 AAGTCTCATTCTGTCGCCCAGGG - Intergenic
1065249084 10:23792516-23792538 GAGTCTCGCTCTGTCATCCCAGG + Intronic
1065557792 10:26934038-26934060 AAGTCTCGCTCTGTCGCCCCAGG + Intergenic
1065896464 10:30167157-30167179 GAGTCTTGCTCTGTTGTCCAGGG + Intergenic
1065956026 10:30694300-30694322 GAGTCTTGCTCTGTTGGCCCAGG + Intergenic
1066114445 10:32227088-32227110 AAGTCTCTCTCTGTTGGCCAGGG - Intergenic
1066585517 10:36930048-36930070 AAGTCTCGCTCTTTTTCCCCAGG - Intergenic
1066691547 10:38033737-38033759 GAGTCTCGCTCTGTTTGCCCAGG + Intronic
1067676235 10:48380213-48380235 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1069128956 10:64674669-64674691 GAGTCTCGTTCTTTTCGCCCAGG - Intergenic
1069468015 10:68659352-68659374 AAGTCTTGCTCTGTTGCCCAGGG + Intronic
1070038464 10:72751378-72751400 GAGTCTCATTCTGTTTCCCCGGG + Intronic
1070581061 10:77719900-77719922 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1071424642 10:85536832-85536854 AGGTCTCTATCTGTTGTACCTGG - Intergenic
1071948888 10:90680226-90680248 AAGACTATTTCAGTTGTCCCAGG + Intergenic
1072144736 10:92624794-92624816 GAGTCTTGCTCTGTTGTCCAGGG + Intronic
1072177013 10:92936564-92936586 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1072187511 10:93055032-93055054 AAGTCTCATTATGTTGCCCAGGG + Intronic
1072353152 10:94578042-94578064 GAGTCTCGCTCTGTCGGCCCAGG - Intronic
1072922474 10:99588067-99588089 AAGTCTTTTTCTGTTTTCCCTGG + Intergenic
1072955065 10:99880894-99880916 AAGTCTCGCTGTGTTGACCAGGG - Intronic
1072958873 10:99911455-99911477 GAGTCTTGCTCTGTTCTCCCAGG - Intronic
1073209953 10:101792042-101792064 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
1073303957 10:102488275-102488297 AAGTCCTGTTCTCTTTTCCCAGG - Exonic
1074511004 10:114112003-114112025 GAGTCTCGATCTGTTGCCCAGGG + Intergenic
1075049834 10:119175419-119175441 GAGTCTCGCTCTGTTCGCCCAGG + Intronic
1075371333 10:121937897-121937919 AAGTCTCGCTCTTGTCTCCCAGG - Intergenic
1075619701 10:123916802-123916824 GAGTCTTGCTCTGTTGTCCAGGG + Intronic
1076112057 10:127867656-127867678 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1077084142 11:739766-739788 GAGTCTCGTTCTGTCGCCCAGGG + Intergenic
1077556666 11:3229249-3229271 GAGTCTGGCTCTGTTGCCCCAGG + Intronic
1077897553 11:6464958-6464980 GAGTCTCGCTCTGTTGCCCAAGG - Intronic
1078051924 11:7972973-7972995 GAGTCTTGTTCTGTTGCCCCGGG + Intronic
1078217796 11:9326296-9326318 GAGTCTCGCTGTGTTGCCCCAGG - Intergenic
1078218573 11:9332600-9332622 CAGTCTTGCTCTGTTGTCCAGGG - Intergenic
1078245692 11:9572281-9572303 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1078413271 11:11145225-11145247 CAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1079000749 11:16753389-16753411 CAGTCTCTCTCTGTTGCCCCAGG + Intronic
1079214932 11:18500828-18500850 AGGTCTCGCTCTGTTGCCCAGGG + Intronic
1079967261 11:26994486-26994508 AAGTCTCCTCCTGGGGTCCCTGG + Exonic
1080315473 11:30942917-30942939 AATTCTCGTTCTGGTGTTTCAGG + Intronic
1080828422 11:35867687-35867709 AAGTCTCGCTCTGTTGCCCACGG - Intergenic
1081499414 11:43651604-43651626 CAGTCTCGCTCTGTCGCCCCAGG + Intronic
1082261725 11:50080970-50080992 AAGTCTTGCTCTGTTGTCCAGGG - Intergenic
1083301460 11:61741635-61741657 AAGTCTCGCTCTTTTCCCCCAGG + Intronic
1083408524 11:62475275-62475297 AAGTCTCGCTCTATTGCCCCAGG - Intronic
1083685764 11:64374156-64374178 GAGTCTGGCTCTGTTGTCCAAGG + Intergenic
1083867448 11:65464366-65464388 GAGTCTCGCTCTGTTGCCCGAGG - Intergenic
1083926076 11:65807652-65807674 GAGTCTCGTTCTGTTCACACAGG - Intergenic
1083983953 11:66197763-66197785 AGGTCTCGTTCTGTTGCCCAGGG - Intronic
1084122067 11:67075328-67075350 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1084717827 11:70884744-70884766 AAGTCTCGTTCTTGTTGCCCAGG + Intronic
1084739502 11:71130138-71130160 AAGTCTCATTCTGAGGTCCTGGG + Intronic
1085087733 11:73682634-73682656 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1085156848 11:74303605-74303627 AAGTCTCGCTCTGTCACCCCAGG + Intronic
1085178212 11:74509053-74509075 AGGTCTTGTTATGTTGCCCCAGG - Intronic
1085286799 11:75367875-75367897 GAGCCTCGTTCTGCTGCCCCAGG - Intergenic
1085485445 11:76859937-76859959 GGGTCTCGCTCTGTTCTCCCAGG + Intergenic
1085990614 11:81838897-81838919 AAGTCTCTCTCTGTTGCCCAAGG - Intergenic
1086726391 11:90189741-90189763 GAGTCTCGTTCTGTCGGCCCAGG - Intronic
1086967978 11:93049904-93049926 AAGTCTCATTCTGGTGTCCTAGG + Intergenic
1087458408 11:98416458-98416480 GAGTCTCGCTTTGTTGGCCCAGG - Intergenic
1088025000 11:105168918-105168940 GAGTTTCGTTCTTTTGGCCCAGG + Intergenic
1088263166 11:107964322-107964344 AGGTCTTGTTCTGTTGACCAGGG + Intergenic
1088416640 11:109596697-109596719 CAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1088639697 11:111859475-111859497 GAGTCTCGCTCTGTTTGCCCAGG - Intronic
1088654487 11:111986388-111986410 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
1088891247 11:114046489-114046511 GAGTCTTGCTCTGTTGTCCAGGG + Intergenic
1089127432 11:116186552-116186574 AAGTCTCGCTCTTGTCTCCCAGG - Intergenic
1089262945 11:117235220-117235242 GAGTCTCACTCTGTTGGCCCAGG + Intronic
1089486654 11:118851672-118851694 GAGTCTCGTTCTGTCGCCCAGGG - Intergenic
1089544636 11:119213968-119213990 GAGTCTCGCTCTTTTGCCCCAGG + Intronic
1089829196 11:121310481-121310503 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
1090353038 11:126119875-126119897 GAGTTTCGTTCTGTTCTCCTAGG - Intergenic
1091450812 12:570929-570951 AAGTGTCGTTCTGCTGTCCATGG - Intronic
1091619158 12:2073123-2073145 AAGTCTTGCTCTGTTTTCCATGG + Intronic
1092616259 12:10218544-10218566 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1093177313 12:15926708-15926730 GAGTCTCGCTCTGTCGCCCCAGG - Intronic
1093920564 12:24855405-24855427 AAGTCTCGCTCTCTTGCCCAGGG + Intronic
1094120811 12:26972440-26972462 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1094461461 12:30700974-30700996 AAATCTAGTTATGTTTTCCCTGG - Intergenic
1094689429 12:32754738-32754760 GAGTCTCCCTCTGTTGCCCCAGG + Intronic
1095907827 12:47395935-47395957 AAGTCTCGCTCTTGTCTCCCAGG + Intergenic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1096314400 12:50551394-50551416 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1096330918 12:50711966-50711988 GGGTCTTGCTCTGTTGTCCCAGG - Intronic
1096618706 12:52848997-52849019 AAGTCTCGTGCTGGGGCCCCAGG - Intronic
1096861073 12:54528650-54528672 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1097226593 12:57480205-57480227 AAGTCTCGTTCTTGTCCCCCAGG + Intronic
1097833872 12:64253731-64253753 AGGTCTTGTTCTGTTCACCCAGG + Intergenic
1097912710 12:64988079-64988101 GAGTCTCGCTCTGTTGCCCAAGG + Intergenic
1098199209 12:68036900-68036922 GAGTCTCGCACTGTTGCCCCCGG + Intergenic
1098206158 12:68112149-68112171 AAGTCTCTTTCATTGGTCCCTGG + Intergenic
1099375104 12:81889411-81889433 GAGTCTCTCTCTGTTGTCCCAGG + Intergenic
1099423064 12:82488224-82488246 AAGTCTCGCTCTTGTCTCCCAGG + Intergenic
1099636795 12:85223740-85223762 AATTCTTTTTCTGTTATCCCTGG - Intronic
1099980856 12:89600672-89600694 AAGTCTCGCTCTTCTCTCCCTGG + Intronic
1100292790 12:93233741-93233763 GAGTCTTGCTCTGTTGCCCCAGG - Intergenic
1100300398 12:93302025-93302047 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
1100491199 12:95079975-95079997 GAGTCTCGCTCTGTCATCCCAGG + Exonic
1100519820 12:95363124-95363146 GAGTCTCATTCTGTTGCCCAGGG - Intergenic
1100974767 12:100111318-100111340 CGGTCTCGCTCTGTTGTCCAGGG + Intronic
1101775036 12:107785978-107786000 CAGTCTCACTCTGTTGTCCAGGG + Intergenic
1102008179 12:109602018-109602040 AATTGTGGTTCTGTTGTACCTGG - Intergenic
1102263438 12:111460106-111460128 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1102280310 12:111613591-111613613 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1102303516 12:111788182-111788204 AAGTCTCGCTCTTGTCTCCCAGG - Intronic
1102315513 12:111884235-111884257 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1102860823 12:116335121-116335143 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
1102987140 12:117287462-117287484 GAGTCTCGCTCTGTTCGCCCAGG + Intronic
1103130782 12:118466677-118466699 AAATCTCACTCTGTTGTCCAGGG - Intergenic
1103241824 12:119419900-119419922 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
1103384310 12:120519842-120519864 AAGTCTCGTTCTTGTTGCCCAGG - Intronic
1103530734 12:121599680-121599702 AAGTCTTGCTCTGTTGCCCCAGG - Intergenic
1105374690 13:19832789-19832811 TAGTCTCATTCTGTTGCCCAGGG + Intronic
1105555486 13:21444127-21444149 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1105687189 13:22795769-22795791 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
1106253892 13:28004496-28004518 AAGTCTCACTATGTTGTCCAGGG + Intronic
1106821039 13:33464807-33464829 GAGTCTCGCTCTGTTGCCCATGG - Intergenic
1107303023 13:38986078-38986100 GAGTCTCACTCTGTTGCCCCTGG + Intronic
1107508442 13:41058945-41058967 GAGTCTCGCTCTGTTAACCCAGG - Intronic
1107947558 13:45433004-45433026 GAGTCTCATTCTGTTGCCCAGGG - Intergenic
1108056582 13:46491394-46491416 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
1108114269 13:47110325-47110347 CAGCCTCTTTCTATTGTCCCTGG + Intergenic
1108135344 13:47351282-47351304 AAGTCTCACTCTGTTTTCCAGGG + Intergenic
1108235681 13:48402401-48402423 GAGTCTCACTCTGTTTTCCCAGG + Intronic
1108367484 13:49730491-49730513 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1108636980 13:52344859-52344881 GAGTCTCGCTCTGTTGCCCAAGG + Intergenic
1108714834 13:53068896-53068918 AAGCTTCTTTCTGTTTTCCCAGG + Intergenic
1108985306 13:56578774-56578796 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1109731019 13:66413657-66413679 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1110235503 13:73213728-73213750 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1110453619 13:75665550-75665572 AAGTCTCGTTCTTGTACCCCAGG + Intronic
1110713571 13:78676350-78676372 GAGTCTCATTCTGTTGCCCATGG + Intergenic
1110857959 13:80317503-80317525 GAGTCTTACTCTGTTGTCCCAGG - Intergenic
1110981262 13:81901946-81901968 GAGTCTCGCTCTGTTGCTCCAGG + Intergenic
1111093145 13:83473555-83473577 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1111553968 13:89855098-89855120 GAGTCTGGCTCTGTTGCCCCAGG - Intergenic
1111773098 13:92624099-92624121 AAGTCTTGCTCTGTTGCCCAGGG + Intronic
1112342214 13:98561949-98561971 GAGTCTCACTCTGTTGACCCAGG - Intronic
1112941005 13:104861600-104861622 AGGTCTCTCTCTGTTTTCCCAGG - Intergenic
1113844259 13:113377176-113377198 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
1115116365 14:29885094-29885116 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1115501218 14:34051505-34051527 GAGTCTCGCTCTGTCGCCCCAGG - Intronic
1117009194 14:51452965-51452987 AAGTCACATTCCGTTCTCCCTGG - Intergenic
1117120617 14:52564246-52564268 AAGTCTCACTCTGTTGCCCAGGG - Intronic
1117410104 14:55442360-55442382 GAGTCTCATTCTGTTGCCCAGGG - Intronic
1117426129 14:55599489-55599511 GAGTCTCGTTCTGTTGCCCAGGG + Intronic
1118101003 14:62602126-62602148 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1118294731 14:64558659-64558681 GAGTCTCGCTCTGTTGCCCCAGG + Intronic
1118940048 14:70325551-70325573 TAGTCTCGCTCTGTTCGCCCAGG - Exonic
1119274885 14:73345880-73345902 AAGTCTCGTTCTTGTCCCCCAGG - Intronic
1119361981 14:74058298-74058320 GAGTCTCGCTCTGTTGCCCAGGG - Exonic
1119599138 14:75963130-75963152 AAATCTCTTTCTGTTTTCCTGGG - Intronic
1119678021 14:76570660-76570682 AAGTCTTGCTCTGTTGCCCAGGG - Intergenic
1119809078 14:77501136-77501158 GAGTCTCGCTCTGTCGCCCCGGG + Intergenic
1120155520 14:81089011-81089033 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
1120292948 14:82600453-82600475 AAGTCACGTTCTGATGTTCCAGG + Intergenic
1120514600 14:85455602-85455624 GAGTCTCATTCGGTTGTCTCAGG + Intergenic
1120794703 14:88619704-88619726 AAGTCTCGCTCTTGTCTCCCAGG + Exonic
1121413090 14:93761322-93761344 GAGTCTCGCTCTGTTGCCCAAGG - Intronic
1121579193 14:95014035-95014057 AGCTCTCGCTCTGTTGTCCATGG + Intergenic
1121934640 14:98006093-98006115 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1122184438 14:99979841-99979863 GAGTCTCGCTCTGTTCGCCCAGG - Intronic
1122436108 14:101700831-101700853 GAATCTCGTTCTGTTGCCCAGGG - Intergenic
1122519417 14:102332882-102332904 AAGTCTCGTTCTTGTCCCCCAGG - Intronic
1122554885 14:102573016-102573038 GAGTCTCGCTCTGTTAGCCCAGG + Intergenic
1122674466 14:103399671-103399693 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1122677101 14:103424497-103424519 AGGTCTCATTCTGTTGTCCAGGG - Intronic
1122682077 14:103472619-103472641 GAGCCTCGCTCTGTTGGCCCAGG - Intronic
1122928028 14:104918201-104918223 GAGTCTTGTTCTGTTGCCCAGGG - Intergenic
1123178295 14:106442867-106442889 AAGTCTCGTGCTTGTGCCCCAGG - Intergenic
1123462355 15:20484797-20484819 GAGTCTCGTTCTGTTTACCCAGG - Intergenic
1123655704 15:22515597-22515619 GAGTCTCGTTCTGTTTACCCAGG + Intergenic
1123673037 15:22679731-22679753 AGGTCTCCCTGTGTTGTCCCTGG - Intergenic
1123679888 15:22755086-22755108 GAGTCTCACTCTGTCGTCCCAGG - Intergenic
1123723571 15:23081068-23081090 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1124050851 15:26196363-26196385 GAGTCTTGCTCTGTTGTCCCAGG - Intergenic
1124273045 15:28300795-28300817 GAGTCTCGTTCTGTTTACCCAGG - Intronic
1124309613 15:28610774-28610796 GAGTCTCGTTCTGTTTACCCAGG + Intergenic
1124325092 15:28753024-28753046 AGGTCTCCCTGTGTTGTCCCTGG - Intergenic
1124332103 15:28829564-28829586 GAGTCTCGCTCTGTCGTCCCAGG - Intergenic
1124605384 15:31166407-31166429 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1124764808 15:32480441-32480463 AAGTCTCGCTCTTTTCGCCCAGG + Intergenic
1125681422 15:41532950-41532972 GAGTCTCGCTCTGTTGTCCTGGG - Intronic
1125708519 15:41764278-41764300 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1126006274 15:44260872-44260894 AGGTCTCGCTCTGTCGGCCCAGG - Intergenic
1126262108 15:46705162-46705184 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1126364787 15:47883096-47883118 TAGTCTAGTTCTGTTGTCTTTGG + Intergenic
1126594292 15:50370061-50370083 GAGTCTCACTCTGTTGCCCCAGG - Intergenic
1126726954 15:51641209-51641231 AAGTCTTGCTCTGTTGCCCAGGG - Intergenic
1126779334 15:52125306-52125328 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1126817881 15:52471722-52471744 GGGTCTCATTCTGTTGCCCCAGG + Intronic
1127076005 15:55326168-55326190 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1127155146 15:56115914-56115936 GAGTCTCGCTCTGTTGGCCCAGG - Intronic
1127161290 15:56189351-56189373 GGGTCTTGTTCTGTTGTCCTGGG - Intronic
1127391836 15:58512122-58512144 GAGTCTCAATCTGTTGCCCCAGG + Intronic
1127832715 15:62764943-62764965 GAGTCTCGCTCTGTTGTCCCAGG - Intronic
1128043496 15:64596177-64596199 GAGTCTCGCTCTGTTGCCCCAGG + Intronic
1128047302 15:64630122-64630144 AAGTCTCGCTCTGTTGCCCGGGG + Intronic
1128051170 15:64666046-64666068 AAGTCTTGCTCTGTTGCCCAGGG - Intronic
1128391075 15:67183066-67183088 AAGTCTCGCTCTTGTCTCCCAGG + Intronic
1128423334 15:67515704-67515726 GAGTCTCATTCTGTTCGCCCTGG - Intergenic
1128428309 15:67566199-67566221 AAGTCTCATTCTGTTGCCTAGGG + Intronic
1129075184 15:72988968-72988990 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
1129342312 15:74894107-74894129 TGGTCTCTTTCTGTTGCCCCAGG + Intronic
1130297824 15:82659661-82659683 AAGCCTCGTTCTGCTGACCCTGG - Exonic
1130319093 15:82824959-82824981 AGGTCTCACTGTGTTGTCCCTGG - Intronic
1130654313 15:85781504-85781526 AAGTTTCGTTCTTTTTGCCCAGG + Intronic
1130662479 15:85841656-85841678 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
1131250572 15:90827596-90827618 GAGTCTCGCTCTGTCGTCCCAGG + Intergenic
1131571249 15:93539148-93539170 AAGTCTCACTCTGTTGCCCAGGG + Intergenic
1132223453 15:100122937-100122959 ATGCCTCTTTCTGTTGTCTCAGG - Intronic
1132984631 16:2758342-2758364 GAGTCTCGCTCTGTTGCCTCAGG - Intronic
1133159552 16:3901366-3901388 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1133163388 16:3928015-3928037 AGGTCTCGCTCTGTTGCCCAGGG + Intergenic
1133202807 16:4214792-4214814 AAGTCTCATTCTGTCGCCCAGGG + Intronic
1133890065 16:9870662-9870684 GAGTCTCGCTCTGTTGCCCAAGG + Intronic
1134149496 16:11795461-11795483 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1134278916 16:12801118-12801140 GAGTCTTGCTCTGTTGTCCAGGG + Intronic
1134281483 16:12820817-12820839 AAGTCTTGTTATGTTGCCCAGGG + Intergenic
1134301700 16:12997431-12997453 CAGTCTCGCTCTGTTGGCCAAGG + Intronic
1134322360 16:13175336-13175358 GAGTCTCATTCTGTTGCCCATGG - Intronic
1134654675 16:15939224-15939246 AAGTCTCACTCTGTTGCCCCAGG + Intergenic
1134873573 16:17675490-17675512 AAGTCTCGCTCTGTCACCCCAGG - Intergenic
1135038843 16:19102024-19102046 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1135102186 16:19615621-19615643 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1135112830 16:19704106-19704128 GAGTCTCATTCTGTTGCCCGGGG + Exonic
1135340381 16:21640738-21640760 GAGTCTCGTTCTGTTGCCCAGGG - Exonic
1135354127 16:21755538-21755560 AAGTCTCACTCTGTTGCCCAAGG + Intronic
1135434091 16:22413665-22413687 GAGTCTCATTCTGTTCACCCAGG + Intronic
1135452616 16:22571679-22571701 AAGTCTCACTCTGTTGCCCAAGG + Intergenic
1135634878 16:24067041-24067063 AGGTCTCGCTGTGTTGCCCCAGG + Intronic
1135689976 16:24528376-24528398 GAGTCTCGCTCTGTTGCCCTGGG - Intergenic
1136139469 16:28279371-28279393 AGATCTTGCTCTGTTGTCCCAGG - Intergenic
1136331931 16:29585337-29585359 AAGTCTCGCTCTTATCTCCCAGG - Intergenic
1136357028 16:29751186-29751208 GAGTCTCGCTCTGTTGTCCAGGG - Intergenic
1136677323 16:31922543-31922565 AAGGCAGGTTCTGGTGTCCCTGG - Intergenic
1136851095 16:33613059-33613081 CAGTCTCACTCTGTTGGCCCAGG - Intergenic
1137339072 16:47581703-47581725 AAGTCTCGCTCTTGTCTCCCAGG + Intronic
1138581584 16:57944922-57944944 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1138695438 16:58808585-58808607 AAGTCTCACTCTGTTGCCCAGGG + Intergenic
1139332153 16:66201686-66201708 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
1139388118 16:66587528-66587550 AAGTCTCGCTCCGTCGTCCGGGG - Intronic
1139702201 16:68714815-68714837 AAGTCTTGCTATGTTGACCCAGG - Intronic
1140001526 16:71030074-71030096 AAGTCTTGCTCTGTTGCCCATGG + Intronic
1140052746 16:71497144-71497166 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1140084517 16:71782511-71782533 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1140112743 16:72017795-72017817 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
1140161888 16:72504664-72504686 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1140382828 16:74505826-74505848 TAGTCTCGCTCTGTTGCCCAGGG - Intronic
1140395275 16:74620950-74620972 GAATCTCACTCTGTTGTCCCAGG - Intergenic
1140658572 16:77165415-77165437 GAGTCTCGTTCTGTTTGCCCAGG + Intergenic
1140868402 16:79084445-79084467 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1141068272 16:80931455-80931477 AAGTCTTTTTCTGTCGTCCAGGG - Intergenic
1141144402 16:81518804-81518826 AGGTCTCGCTATGTTGCCCCAGG - Intronic
1141494083 16:84394894-84394916 AAGTCACATTCTGGTGTACCAGG + Intronic
1141601964 16:85132436-85132458 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1142052937 16:87971817-87971839 GGGTCTCGTTCTGTTGTCCAGGG + Intronic
1142214310 16:88823357-88823379 AATTCTCTTTCTGCTGCCCCTGG + Intronic
1142528600 17:563319-563341 GAGTCTTGCTCTGTTGGCCCAGG + Intronic
1142803364 17:2358901-2358923 AAGTCTCGCTGTGTTCCCCCAGG + Intronic
1143066401 17:4252005-4252027 GAGTCTCGTTCTGTTGCCCAGGG - Intronic
1143152522 17:4816354-4816376 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1143807849 17:9444179-9444201 GAGTCTTGCTATGTTGTCCCAGG + Intronic
1144353411 17:14421651-14421673 GAGCCTCGCTCTGTTGGCCCAGG + Intergenic
1144501559 17:15791828-15791850 GAGTCTCGCTCTGTCGTGCCAGG + Intergenic
1144554093 17:16266620-16266642 GAGTCTCGCTCTGTTGCCCAAGG + Intronic
1144730182 17:17521588-17521610 GAGTCTCGCTCTGTTGCCCCAGG + Intronic
1144868702 17:18354568-18354590 AAGTCTCGCTCTTGTTTCCCAGG - Intronic
1145181804 17:20759656-20759678 GAGTCTCCCTCTGTTGGCCCAGG + Intergenic
1145190354 17:20836326-20836348 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1145215059 17:21044688-21044710 GAGTCTCGCTCTGTTGCCCAAGG + Intergenic
1145401565 17:22540204-22540226 GAGTCTTGCTCTGTTGCCCCAGG - Intergenic
1146030646 17:29363333-29363355 GAGTCTCGCTCTTTTCTCCCAGG - Intergenic
1146030813 17:29364525-29364547 AAGTCTCATTCTGTCGCCCAGGG - Intergenic
1146121610 17:30200803-30200825 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1146133209 17:30296072-30296094 AAGTCTCGTTCTTGTCCCCCGGG + Intergenic
1146251815 17:31352932-31352954 AAGTCTTGTTCTGTTCACCCAGG + Intronic
1146302688 17:31702539-31702561 AAGTCTCGCTCTGGTTGCCCAGG + Intergenic
1147012014 17:37457521-37457543 GAGTCTCGCTCTGTTGCCCCAGG + Intronic
1147202367 17:38811512-38811534 GAGTCTCGCTCTGTTGCCCAAGG - Intronic
1147224343 17:38964633-38964655 AAGTCTCACTGTGTTGCCCCAGG - Intronic
1147342165 17:39759395-39759417 AAGTCTCGCTCTGTTTCCCCAGG - Intergenic
1147479313 17:40744279-40744301 AAGTCTTGCTCTGTCGTCCGTGG + Intergenic
1147800588 17:43083887-43083909 CAGTCTTGCTCTGTTGCCCCAGG + Intronic
1147842741 17:43383507-43383529 AAGTCTCGCTCTGTGGCCCGTGG - Intergenic
1148023652 17:44570149-44570171 AAGTCTCGCTCTCTTTCCCCAGG + Intergenic
1148177668 17:45581730-45581752 ATGTCTCGCTCTGTTGCCCAGGG - Intergenic
1148512712 17:48186510-48186532 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1148622929 17:49048277-49048299 GAGTCTCGCTGTGTTGTCCAGGG + Intronic
1148728008 17:49810059-49810081 AACTCTAGCTATGTTGTCCCGGG + Intronic
1148834374 17:50458106-50458128 AAGGTTCCTTCTGATGTCCCTGG + Intronic
1149002767 17:51774464-51774486 GAGTCTCGCTCTGTTGCCCAAGG + Intronic
1150179515 17:63102106-63102128 AGGTCTCATTATGTTGTCCAGGG - Intronic
1150327243 17:64267048-64267070 AGGTCTTGCTGTGTTGTCCCAGG + Intergenic
1150345456 17:64401200-64401222 GAGTCTTGCTCTGTTGCCCCAGG - Intronic
1150561313 17:66297443-66297465 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1150677237 17:67254984-67255006 AAGTCTCACTCTTTTGCCCCTGG - Intergenic
1151199415 17:72456674-72456696 GAGTCTCGCTCTGTTTGCCCAGG + Intergenic
1151292707 17:73162078-73162100 GAGTCTCACTCTGTTGTCCAAGG - Intergenic
1151708965 17:75789360-75789382 GAGTCTCGCTCTGTTGCCCTTGG + Intronic
1151781025 17:76245523-76245545 CAGTCTCCTTCTGTGGCCCCAGG - Intergenic
1152702813 17:81827805-81827827 GAGTCTCGCTCTGTCGTCCAGGG + Intronic
1152792047 17:82285666-82285688 AAGTCTCACTCTGTTTTGCCCGG - Intergenic
1152959747 18:72561-72583 AGGTCTCGCTCTGTTGCCCAGGG + Intronic
1153165965 18:2262654-2262676 AAGTCTCACTATGTTGTCCAGGG - Intergenic
1153609638 18:6870824-6870846 GAGTCTCGCTCTATTGCCCCAGG + Intronic
1154533383 18:15371361-15371383 AGGTTTTGCTCTGTTGTCCCAGG + Intergenic
1154984117 18:21531865-21531887 GAGTCTCATTCTGTTGTTCCGGG - Intronic
1155305665 18:24475597-24475619 GGGTCTCGTTCTGTTGCCCAGGG - Intronic
1155431426 18:25763347-25763369 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1155816427 18:30317091-30317113 AAGTCTCGCTCTTGTGTCCCAGG + Intergenic
1155963429 18:32014929-32014951 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
1156817417 18:41327936-41327958 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
1157663044 18:49462077-49462099 GTGTCTCGTTCTGTTGCCCAGGG - Intergenic
1157832665 18:50871240-50871262 AAGGCTCATTCTGATGTCCATGG + Intergenic
1158263447 18:55634241-55634263 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1158870319 18:61680597-61680619 AAGTCTCAATATGTTGTCCTAGG + Intergenic
1159111142 18:64057807-64057829 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
1159547548 18:69858754-69858776 GAGTCTCGCTCTGTTGCCCAGGG + Exonic
1159967557 18:74610574-74610596 AAGTCTCGTTCTTGTCCCCCAGG + Intronic
1160140856 18:76320970-76320992 AAGTCTCGCTCTTTTCCCCCAGG - Intergenic
1160201462 18:76799494-76799516 AAGTCTCACTCTGTTGCCCCAGG - Intronic
1160612385 18:80098641-80098663 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1160949824 19:1660335-1660357 GAGTCTCATTCTTGTGTCCCAGG - Intergenic
1160957955 19:1702788-1702810 GAGTCTCATTCTGTTCGCCCAGG + Intergenic
1161114765 19:2490465-2490487 AAGTCTCGCTCTTGTGCCCCAGG + Intergenic
1161183091 19:2898742-2898764 ACGTCTTGCTCTGTTGTCCAGGG - Intergenic
1161374946 19:3934605-3934627 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
1161641690 19:5427610-5427632 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1161970031 19:7573310-7573332 AAGTCTCACTCTGTTGCCCCAGG - Intergenic
1162012494 19:7826173-7826195 AAGTCTCGTTCTTGTCCCCCAGG - Intergenic
1162136818 19:8560457-8560479 AAGTCTCGCTATGTTTGCCCAGG - Intronic
1162620787 19:11841964-11841986 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1162701527 19:12518761-12518783 AAGTCTCGCTCTTGTCTCCCAGG - Intronic
1162900192 19:13790641-13790663 AAGTCTTGTTGTGTTGCCCATGG - Intergenic
1163037619 19:14580151-14580173 AAGTCTCGTTCTTGTCCCCCAGG + Intergenic
1163363696 19:16864265-16864287 GGGTCTCATTCTGTTGTCCAGGG - Intronic
1163794181 19:19326863-19326885 GGGTCTCGGTCTGTTGTCCAGGG - Intronic
1164169389 19:22711482-22711504 AATTCTCGCTCTGTTGCCCCAGG + Intergenic
1164873215 19:31664276-31664298 AGGTCTCACTCTGTTGCCCCAGG - Intergenic
1165876556 19:39011852-39011874 GAGTCTCTTTCTGTCATCCCAGG + Intronic
1166090057 19:40502990-40503012 AAGTCTCCCTCTCTGGTCCCAGG - Intronic
1166119791 19:40679063-40679085 GAGTCTCGCTCTGTTGCCCCAGG - Intronic
1166216080 19:41336019-41336041 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
1166221587 19:41368458-41368480 GAGTCTCGTTCTGTGGGCCAGGG + Intronic
1166340689 19:42134961-42134983 GAATCTCGCTCTGCTGTCCCCGG - Intronic
1167329381 19:48845446-48845468 AAGTCCCGTTCTGTCTTTCCAGG - Exonic
1167482366 19:49740856-49740878 GAGTCTCGCTCTGTTGCTCCAGG - Intronic
1167870471 19:52365209-52365231 GAGTCTCTCTCTGTTGCCCCAGG - Intronic
1167928406 19:52843092-52843114 GAGTCTCACTCTGTTGTCCAGGG - Intronic
1168089480 19:54072949-54072971 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1168122604 19:54260512-54260534 GAGTCTCGCTCTGTCATCCCAGG - Intronic
1168232004 19:55038613-55038635 AAGTCTCGTTCTTTTTGCCCAGG + Intergenic
1168399866 19:56079396-56079418 GAGTCTTGCTCTGTTGTCCAGGG - Intergenic
1168688640 19:58363442-58363464 GAGTCTCGTTCTGTCGCCCCAGG - Intergenic
926184638 2:10679650-10679672 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
927000805 2:18792398-18792420 AAATCTTTTTCTGTTTTCCCTGG + Intergenic
927535521 2:23854650-23854672 AAGTCTCGATCTTGTGCCCCAGG - Intronic
927543982 2:23937049-23937071 GAGTCTCGCTATGTTGCCCCAGG + Intronic
928019504 2:27691616-27691638 GAGTCTCATTCTGTTGCCCAGGG + Intronic
928106884 2:28476272-28476294 AAGTCTCGCTCTTGTCTCCCAGG - Intronic
928498659 2:31863306-31863328 CAGTCTCGCTCTGTTGCCCCAGG - Intergenic
928659889 2:33491288-33491310 CAGTCTCACTCTGTTGCCCCAGG - Intronic
928785814 2:34884925-34884947 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
928924791 2:36566311-36566333 GAGTCTCGCTCTGTCGTCCAGGG - Intronic
929477363 2:42265115-42265137 GAGTCTCATTCTGTTGCCCAGGG + Intronic
929525868 2:42702183-42702205 AAGTCTCGCTCTTGTGACCCAGG - Intronic
929650039 2:43669730-43669752 GAGTCTCACTCTGTTGGCCCAGG + Intronic
930041822 2:47131151-47131173 AAGTCTCACTCTGTTGCCCACGG + Intronic
930259420 2:49127299-49127321 AAGTCTTGCTCTGTTGTCCAGGG - Intronic
930423682 2:51186449-51186471 GAGTCTCGCTCTGTTGGCCCAGG + Intergenic
930784758 2:55261011-55261033 GAGTCTCGCTCTGTCGTCCAGGG + Intronic
930785340 2:55266792-55266814 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
930824035 2:55677568-55677590 TAGTCTCGCTCTGTTGCCCAGGG - Intronic
930936893 2:56964237-56964259 AAGTCTCGCTCTGTCGGCCCAGG + Intergenic
931139651 2:59443517-59443539 AAGTCTCACTCTTTAGTCCCAGG - Intergenic
931275740 2:60742263-60742285 AAGTCTCGCTCTGTTGCCCAGGG - Intergenic
931285084 2:60825418-60825440 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
931347749 2:61462211-61462233 GAGTCTTGTTCTGTTGCCCCAGG - Intronic
931505051 2:62916564-62916586 GAGTCTCGCTCTGTTGCCCAAGG - Intronic
931580188 2:63763473-63763495 AAGTCTTGTTCTGTTGCCCAGGG - Intronic
932658588 2:73632034-73632056 AAGCCTCTTTGTGTTTTCCCAGG + Intergenic
932957444 2:76370315-76370337 AAGACTCATTTTGTTGTTCCTGG + Intergenic
932962178 2:76426006-76426028 AAGTCTCGCTCTGTTGCCCAGGG - Intergenic
933827894 2:86180049-86180071 AGGTCTTGTTCTGTTGCTCCAGG - Intronic
933906170 2:86895486-86895508 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
934079379 2:88454245-88454267 AAGTCTTGCTCTGTTGTCCAGGG + Intergenic
934575573 2:95398731-95398753 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
935767012 2:106378632-106378654 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
936365996 2:111856206-111856228 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
936986113 2:118312488-118312510 AAGACTCGTTCAGTTTTCCTTGG + Intergenic
938469687 2:131547025-131547047 AAGTCTCATTCTTTTCCCCCAGG + Intergenic
939615134 2:144354199-144354221 AAGTCTCGTTCTTGTCTCCCAGG + Intergenic
940346194 2:152631364-152631386 GAGTCTCGTTCTGTCGCCCAGGG - Intronic
940698531 2:157011983-157012005 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
940967197 2:159852442-159852464 GAGTCTCGCTCTGTTGCCCGGGG + Intronic
942100057 2:172571856-172571878 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
942174062 2:173314042-173314064 AAGTCTCGCTCTTTTCTCCCAGG - Intergenic
942296206 2:174519443-174519465 AAGTCTCGTTCTTGTCCCCCAGG - Intergenic
943328086 2:186525712-186525734 AAGTCTCGCTCTGTCGCCCAGGG + Intergenic
943531139 2:189082665-189082687 AATTCTCATTCTGCTGACCCAGG + Intronic
943788796 2:191908730-191908752 GAGTCTCATTCTGTTGTCCAGGG + Intergenic
944170822 2:196775310-196775332 AAGTCTTGTTATGTTGGCTCAGG + Intronic
944846286 2:203671531-203671553 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
945422644 2:209658530-209658552 AAGTCTCGCTCTTGTCTCCCAGG + Intronic
945588805 2:211701728-211701750 GAGTCTCGCTCTGTTGCCCCAGG - Intronic
946221300 2:218229994-218230016 GAGTCTCACTCTGTTGCCCCAGG + Intronic
946449081 2:219764321-219764343 CAGTCTCATTCTGAAGTCCCGGG + Intergenic
947417910 2:229917352-229917374 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
947508659 2:230730468-230730490 AAGTCTCGCTCTTGTGCCCCAGG + Intronic
947920200 2:233863775-233863797 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
948125633 2:235563021-235563043 GGGTCTTGTTCTGTTGCCCCAGG - Intronic
948970535 2:241422116-241422138 CAGTCTCGCTCTGTTGCCCAGGG - Intronic
1169136617 20:3201682-3201704 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1169357076 20:4915919-4915941 GAGTCTCGCTCTGTTGACCAGGG - Intronic
1169809921 20:9599117-9599139 AAGACTTGTTCTTTTGTCCCTGG + Intronic
1170027519 20:11906289-11906311 GAGTCTCGTTCTGTAGCCCAGGG + Intronic
1170193491 20:13667027-13667049 GAGTCTTGTTCTGTTGCCCAGGG + Intergenic
1170984828 20:21247862-21247884 AAGTCTCGTTCTTGTCGCCCAGG - Intergenic
1171382049 20:24741729-24741751 GAGCCACCTTCTGTTGTCCCTGG - Intergenic
1172334768 20:34106110-34106132 GGGTCTCCCTCTGTTGTCCCAGG + Intronic
1172527757 20:35610716-35610738 GAGTCTCGCTCTGTTGGCCCAGG - Intergenic
1172691340 20:36792477-36792499 AAGTCTCGTTCTTGTCCCCCAGG - Intronic
1173475521 20:43356386-43356408 AAGTCTCGCTCTGTCGCCCAAGG - Intergenic
1173745178 20:45431177-45431199 AAATCTTGTTATGTTGTCCAGGG + Intergenic
1174461468 20:50686080-50686102 GAGTCTCGCTCTGTTGCCCCAGG + Intronic
1176211531 20:63925455-63925477 GAGTCTCGCTCTGTTTGCCCAGG - Intronic
1177448443 21:21231385-21231407 AAGTCTTATACTGTTTTCCCAGG - Intronic
1178117703 21:29434638-29434660 AGGTCTGGTCCTGTTGTCCCTGG + Intronic
1178138766 21:29658286-29658308 GAGTCTCATTCTGTCGCCCCAGG + Intronic
1178249365 21:30987293-30987315 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
1178273515 21:31215533-31215555 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1178325018 21:31638399-31638421 GAGTCTTGTTCTGTTGTCCAGGG + Intergenic
1178676099 21:34633164-34633186 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1178898882 21:36583400-36583422 AAGTCACATTCTGAGGTCCCAGG + Intergenic
1179140360 21:38719735-38719757 GAGTCTCATTCTGTTGCCCAGGG - Intergenic
1179659256 21:42864079-42864101 GAGTCTCGCTCTGTCGCCCCAGG - Intronic
1179782837 21:43713423-43713445 GAGTCTCGCCCTGTTGCCCCAGG + Intergenic
1180138101 21:45874529-45874551 GAGTCTTGCTCTGTCGTCCCGGG + Intronic
1180623758 22:17180102-17180124 GAGTCTCGCTCTGTTGCCCAGGG - Exonic
1180691187 22:17717352-17717374 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1180982488 22:19885392-19885414 AAGTCTCCAGCTGCTGTCCCGGG + Intronic
1181130014 22:20725701-20725723 GAGTTTCGCTATGTTGTCCCAGG - Intronic
1181178408 22:21050952-21050974 GAGTCTCGCTCTGTTGCCCGGGG - Intronic
1181381849 22:22511103-22511125 GAGTCTCGCTCTGTTGCCCAAGG - Intergenic
1181496519 22:23290298-23290320 AGGTCAGCTTCTGTTGTCCCGGG - Intronic
1182187379 22:28420622-28420644 GAGTCTCGTTCTGTCGCCCAGGG + Intronic
1182283020 22:29228297-29228319 GAGTCTCGCTCTGTCGTCCAGGG - Intronic
1182749289 22:32628720-32628742 AAGTCTCGCTCTTGTGCCCCAGG - Intronic
1182853821 22:33499797-33499819 AAGTCTCGCTCTGTCCACCCAGG + Intronic
1183504142 22:38199759-38199781 GAGTCTCGCTGTGTTGCCCCAGG - Intronic
1183907672 22:41054406-41054428 AAGTCTCGCTCTTATTTCCCAGG - Intergenic
1183908210 22:41059075-41059097 GAGTCTCGCTCTGTTGCCCAAGG + Intergenic
1183997280 22:41644509-41644531 GAGTCTTGGTCTGTCGTCCCAGG + Intronic
1184027207 22:41866630-41866652 AAGTCCTGTCCTGTTGTCCTGGG + Intronic
1184093530 22:42304587-42304609 AAGTCTACGTCTGTTGTGCCAGG + Intronic
1185293093 22:50037229-50037251 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
1203295799 22_KI270736v1_random:42080-42102 AAGTCTCGTTCTTGTCACCCAGG - Intergenic
949856691 3:8468394-8468416 CAGTATGGTTGTGTTGTCCCTGG + Intergenic
949981797 3:9506605-9506627 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
950363520 3:12466679-12466701 GAGTCTTGCTCTGTTGGCCCAGG - Intergenic
950695188 3:14694814-14694836 AAGTCTCACTCTGTTGCCCCAGG + Intronic
950804968 3:15593821-15593843 AAGTCTCGTTCTTGTTCCCCAGG + Intronic
953142859 3:40245621-40245643 GAGTCTCACTCTGTTGCCCCAGG - Intronic
953378602 3:42449140-42449162 GAGTCTCGCTCTGTTTTCCCAGG - Intergenic
953595911 3:44313589-44313611 GAGTCTCGCTTTGTTGCCCCAGG - Intronic
953762264 3:45698574-45698596 AAGTCTCGCTCTTGTGCCCCAGG + Intronic
953874172 3:46655844-46655866 GAGTCTCGCTCTGTTGCCCAAGG - Intergenic
953887834 3:46727389-46727411 GAGTCTCGTTCTGTGGCCCCAGG - Intronic
954045897 3:47930102-47930124 CAGTCTCACTCTGTTGCCCCAGG - Intronic
954076438 3:48185218-48185240 AAGTCTCACTATGTTGCCCCAGG - Intronic
954142519 3:48616244-48616266 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
954205446 3:49055696-49055718 AAGTCTTGCTATGTTGCCCCAGG + Intronic
954768559 3:52944543-52944565 AAGTTTCGCTCTGTTCACCCAGG + Intronic
955227442 3:57072700-57072722 GAGTCTCGTTCTGTTGCCCAGGG - Intronic
955807378 3:62751471-62751493 GAGTCTCGTTCTGTTGCCCAGGG + Intronic
955914647 3:63894548-63894570 GAGTCTCATTCTTTTGCCCCAGG + Intronic
956275129 3:67491388-67491410 AAGTCTCGCTCTTGTCTCCCAGG + Intronic
956284905 3:67598005-67598027 GAGTCTTGTTCTGTTGCCCAGGG + Intronic
956416723 3:69039121-69039143 AAGTCTCGCTCTATTGCCCAGGG + Intronic
957400669 3:79708668-79708690 AAGTCTCACTCTGTTGACCAGGG - Intronic
957820688 3:85370185-85370207 GAGTTTCGTTCTTGTGTCCCAGG - Intronic
959089784 3:101889697-101889719 AAGTCTCACTCTGTTGCCCAGGG + Intergenic
959225792 3:103582615-103582637 TAGTCTCTCTCTGTTGGCCCAGG - Intergenic
959989693 3:112617283-112617305 AAGGCCTGTTCTGTGGTCCCAGG + Intronic
960761335 3:121076442-121076464 CAGTCTCTTTCTGTGGTTCCTGG + Intronic
961021854 3:123514247-123514269 AAGTCTCACTCTGGTGCCCCAGG - Intronic
961169088 3:124783262-124783284 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
961608509 3:128116500-128116522 AAGTCTCGCTCTCTTGCCCAGGG - Intronic
962073342 3:132054699-132054721 AACTCTGGTTCTGTTTTCTCTGG + Intronic
962311940 3:134332902-134332924 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962523230 3:136215996-136216018 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
962546472 3:136441057-136441079 AAGTCTCACTCTGTTGCCCAGGG + Intronic
963012490 3:140785343-140785365 AAGTCTTGCTCTGCTGTCCACGG - Intergenic
963782517 3:149500995-149501017 AGGTCTTGTTCTGTTATCCAGGG - Intronic
963876189 3:150478388-150478410 GAGTCTCGCTCTGTCGGCCCAGG + Intergenic
964132985 3:153312136-153312158 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
964192241 3:154016689-154016711 GAGTCTTGCTCTGTTGTCCAGGG + Intergenic
964359909 3:155884357-155884379 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
964362523 3:155913546-155913568 GAGTCTTGTTCTGTTGCCCAGGG + Intronic
964792393 3:160464210-160464232 GAGTCTCGCTCTGTTGCCCAAGG - Intronic
964801883 3:160565934-160565956 AAGTAACGTTCTTTTCTCCCCGG + Intergenic
964969262 3:162539802-162539824 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
965071027 3:163915316-163915338 GAGTCTTGCTCTGTTGCCCCAGG - Intergenic
965528819 3:169749994-169750016 GAGTCTCATTCTGTTGCCCAGGG - Intergenic
965736591 3:171827096-171827118 GAGTCTCGCTCTGTGGCCCCAGG - Intergenic
966059228 3:175734528-175734550 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
966125607 3:176572679-176572701 AGGTCTCATTCTATTGTCCAGGG - Intergenic
966167012 3:177031084-177031106 AAGTCTCGCTCTTGTGCCCCAGG - Intronic
966522030 3:180883940-180883962 GAGCCTCGCTCTGTTGTCCAAGG - Intronic
966708623 3:182947073-182947095 GAGTCTCATTCTGTTGCCCAGGG - Intronic
966732579 3:183162982-183163004 AAGTCTCGCTCTGTCGCCCAGGG + Intronic
967165395 3:186775369-186775391 GGGTCTTGTTCTGTTGCCCCCGG + Intergenic
967728767 3:192887171-192887193 AAGTCTCGTTCTGTTTCCCAGGG + Intronic
968212386 3:196859847-196859869 GAGTCTTGTTCTGTTGCCCAGGG - Intergenic
968271277 3:197405429-197405451 AAGTCTCGTTCTTGTCCCCCAGG - Intergenic
968316423 3:197729583-197729605 CAGTCTCGATCTGTTGCCCAGGG + Intronic
968845297 4:3037886-3037908 AAGTCTCGTTCTGTCGCCCAAGG - Intronic
969727142 4:8927040-8927062 GAGTCTCATTCTGTTGCCCAGGG + Intergenic
970090837 4:12406033-12406055 GAGTCTCACTCTGTTGCCCCTGG - Intergenic
970590631 4:17557214-17557236 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
970957793 4:21835248-21835270 AAGTAGCCTTCTGTTGTCTCTGG - Intronic
970967421 4:21944528-21944550 GAGTCTCATTCTGTTGCCCAGGG - Intronic
970976177 4:22045732-22045754 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
971035743 4:22691303-22691325 GAGTCTCATTCTGTTGCCCAGGG + Intergenic
972001845 4:34046859-34046881 AACTCTGGTTCAGTTGACCCAGG + Intergenic
973574050 4:52268041-52268063 AAGTCTCTCTCTGTTGCCCAGGG + Intergenic
974374495 4:61059335-61059357 CAGTCTCCCTCTGTTGCCCCAGG + Intergenic
975216291 4:71760067-71760089 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
975460196 4:74643563-74643585 AAGTCTCGATCTCTTGACCTCGG + Intergenic
976404954 4:84652894-84652916 GGGTCTCGCTCTGTTGCCCCAGG + Intergenic
976409231 4:84693867-84693889 GAGTCTCGCTTTGTTGCCCCAGG - Intronic
976983723 4:91266276-91266298 GAGTCTCACTCTGTTGGCCCAGG + Intronic
977804905 4:101285823-101285845 AAGTCTTGGTCTGTGTTCCCTGG - Intronic
977948936 4:102947400-102947422 GGGTCTCATTCTGTTGTCCAAGG + Intronic
978180296 4:105786486-105786508 AAGTCTTGCTCTGTTGCCCAGGG - Intronic
978877620 4:113660819-113660841 GAGTCTCGCTCTCTCGTCCCAGG + Intronic
978954110 4:114594694-114594716 CAGTCTCTTTCTATTGTTCCTGG + Intergenic
979938609 4:126730690-126730712 AAGTCTCGCTCTTGTGCCCCAGG + Intergenic
980116150 4:128680773-128680795 AAGTCTCGCTCTGTTGCCCAGGG - Intergenic
980533105 4:134079550-134079572 AAGTCTTGCTCTGTTGTCCAGGG - Intergenic
980688468 4:136260748-136260770 AAGTCTCAGTTTGATGTCCCTGG - Intergenic
980739171 4:136928766-136928788 ACCTCTCCTTCTGTTGTTCCTGG - Intergenic
980854654 4:138424811-138424833 AAGGCTCTTTCTGATCTCCCTGG + Intergenic
980948744 4:139349957-139349979 CAGTCTCGCTCTGTTGCCCAGGG - Intronic
981564107 4:146080248-146080270 AGGTCTTGCTCTGTTGCCCCAGG + Intergenic
981929282 4:150172579-150172601 GAGTCTTGCTCTGTTGCCCCAGG - Intronic
982594124 4:157355500-157355522 AAGTCTCGTTCTTGTCCCCCAGG - Intronic
982664784 4:158248931-158248953 GAGTCTCGCTCTGTTGCCCACGG + Intronic
983404846 4:167314890-167314912 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
983511865 4:168617479-168617501 TAGTCTTGTTCTGGTGACCCAGG - Intronic
983738325 4:171091583-171091605 GAGTCTCGCTCTGTCGGCCCAGG - Intergenic
983851307 4:172583865-172583887 GAGTCTCGCTCTGTCGGCCCAGG - Intronic
984248043 4:177299320-177299342 AAGTCTCACTCTGTTGCCCAGGG + Intergenic
984352074 4:178608334-178608356 GAGTCTCGTTCTGTTGCCCAAGG + Intergenic
984767572 4:183411117-183411139 GAGTCTCGTTCTGTTGCCCAGGG - Intergenic
985021784 4:185699311-185699333 GAGTCTCGCTCTGTTGGCCAGGG + Intronic
985257153 4:188081743-188081765 CAGTCTCGTTCTGTCGCCCAGGG + Intergenic
985586875 5:744842-744864 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
985601450 5:837028-837050 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
985991720 5:3567247-3567269 AAGTCTTGTTCTTTTCCCCCAGG - Intergenic
986109380 5:4696338-4696360 GAGTCTCATTCTGTTGCCCAGGG - Intergenic
986390853 5:7286881-7286903 GAGTCTCGCTCTGTCGTCCCAGG - Intergenic
987036575 5:14024931-14024953 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
987061499 5:14248037-14248059 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
987148457 5:15015675-15015697 AAGTCTCGCTCTTGTCTCCCAGG + Intergenic
987429549 5:17815816-17815838 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
987508662 5:18807168-18807190 AAGTCTCACTCTGTTGCCCAGGG + Intergenic
987935673 5:24461811-24461833 AAGTCTCACTCTGTTCACCCCGG + Intergenic
987961461 5:24814485-24814507 GAGCCTCGTTCTGTTGCCCAGGG - Intergenic
988531573 5:32032205-32032227 GAGGCTGGTTCTGTTGGCCCAGG + Intronic
988897312 5:35691823-35691845 GAGTCTCGCTCTGTTGGCCCAGG + Intronic
989374135 5:40741961-40741983 GAGTCTCGCTCTGTTGGCCCAGG - Intronic
990468756 5:56093963-56093985 AGGTCTCACTCTGTTGCCCCAGG - Intergenic
990567894 5:57048330-57048352 AAGTCTTGCTCTGTTGCCCAGGG - Intergenic
990570721 5:57075623-57075645 ATGTCTTGCTATGTTGTCCCAGG - Intergenic
991059737 5:62360658-62360680 AAGTCTCGTTCTCGTCCCCCAGG - Intronic
991672044 5:69057327-69057349 GAGTCTCGTTCTGTCATCCAGGG - Intergenic
991683080 5:69157563-69157585 AAGTCTCATTCTTGTGGCCCAGG - Intergenic
992807230 5:80349780-80349802 AAGTCTCGCTCTTGTGGCCCAGG + Intergenic
992819942 5:80486195-80486217 AAGTCTCACTCTGTTCCCCCAGG - Intergenic
993114343 5:83701897-83701919 AAGTCTCGCTCTGTCGCCCAAGG - Intronic
993489972 5:88535304-88535326 GAGTCTCGCTCTGTTCACCCAGG + Intergenic
994125103 5:96160112-96160134 GAGTCTTGCTCTGTTCTCCCAGG - Intergenic
994822368 5:104669362-104669384 GAGTCTCGCTCTTTTCTCCCAGG - Intergenic
996283798 5:121764960-121764982 TAGTCACATTCTGTTGTCCTGGG - Intergenic
996736433 5:126762975-126762997 AAGTCTTGCTCTGTTGGCCAGGG + Intergenic
997330100 5:133053683-133053705 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
997925678 5:138028992-138029014 AAGTCTCGTTCTTGTCCCCCTGG - Intronic
998069694 5:139187489-139187511 GAGTCTTGCTCTGTTGCCCCAGG - Intronic
998123462 5:139598952-139598974 AAGTCTCGTTCTGTTGTCCCAGG + Intronic
998249619 5:140543067-140543089 AAGTCTCGTTCTTGTCACCCAGG - Intronic
1000489516 5:161892976-161892998 GAGTCTCGCTCTGTTGCTCCAGG - Intronic
1000887007 5:166758898-166758920 GAGTCTCGCTCTGTCGCCCCAGG - Intergenic
1001283452 5:170405219-170405241 AAGTCTTGCTCTGTTGCCCAGGG + Intronic
1001392987 5:171395323-171395345 AAGTCTCGCTCTTGTGCCCCAGG + Intronic
1001606964 5:172967437-172967459 GAGTCTCGCTCTGTTCCCCCAGG - Intronic
1002684857 5:181001816-181001838 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1004547345 6:16610829-16610851 ACGTCTCGATGTGTTGTCCCGGG - Intronic
1004962543 6:20807247-20807269 GAGTCTCGCTGTGTTGCCCCAGG + Intronic
1005454789 6:26008898-26008920 AAGTCTCGCTCTGTCGCCCAGGG + Intergenic
1005530808 6:26703560-26703582 AAGTGCAGTTCTGTTGTCACTGG - Intergenic
1005539988 6:26798086-26798108 AAGTGCAGTTCTGTTGTCACTGG + Intergenic
1005621299 6:27622928-27622950 GAGTCTCACTCTGTTGCCCCAGG - Intergenic
1005830039 6:29663244-29663266 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1005941856 6:30566451-30566473 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1006648054 6:35528855-35528877 AAGTCTCGCTCTTGTGCCCCAGG + Intergenic
1006813272 6:36834627-36834649 GAGTCTCGTTCTGTCATCCAGGG - Intronic
1007660276 6:43480542-43480564 AAGTCTCGTTCTTGTCGCCCAGG + Intronic
1007660756 6:43484431-43484453 AAGTCTCGCTCTTGTGCCCCAGG - Intronic
1007675053 6:43586453-43586475 AAGTCTCGCTCTTGTCTCCCAGG - Intronic
1008112543 6:47508570-47508592 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1008161181 6:48078237-48078259 AAGTCTCAGTCTGTCTTCCCTGG + Intergenic
1008233395 6:49013028-49013050 AATTCTCTTTCTGTAGTTCCAGG - Intergenic
1009010805 6:57840218-57840240 AAGTGCAGTTCTGTTGTCACTGG + Intergenic
1010188744 6:73172334-73172356 GAGTCTTGTTCTGTTGCCCAGGG - Intronic
1011271773 6:85587489-85587511 GAGTCTCGCTCTGTCATCCCAGG + Intronic
1011567287 6:88689566-88689588 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1011694583 6:89900801-89900823 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
1012465373 6:99511472-99511494 AAGTCTCACTCTGATGGCCCAGG + Intronic
1012488350 6:99747649-99747671 AAGTCTCATTCTGTCGCCCAAGG - Intergenic
1013109280 6:107052103-107052125 AAGTCTCACTATGTTGCCCCAGG - Intergenic
1013110339 6:107060034-107060056 AAGTCTCGCTCTTGTGCCCCAGG + Intergenic
1013130381 6:107227016-107227038 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1013502492 6:110766549-110766571 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1013924759 6:115457616-115457638 GAGTCTTTATCTGTTGTCCCAGG - Intergenic
1015119453 6:129685479-129685501 GAGTCTTGCTCTGTTGGCCCAGG - Intronic
1015535568 6:134264143-134264165 GAGTCTCGCTCTGTTGCCCCTGG + Intronic
1016261840 6:142181158-142181180 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1016339166 6:143042852-143042874 GAGTCTCACTCTGTTGCCCCGGG + Intergenic
1016448015 6:144152657-144152679 GAGTCTCACTCTGTTGCCCCAGG + Intronic
1016479262 6:144464524-144464546 GAGTCTTGCTCTGTTGCCCCAGG + Intronic
1016960819 6:149671157-149671179 GAGTCTCGCTCTGTCATCCCAGG + Intronic
1017057326 6:150449207-150449229 GAGTCTCACTCTGTTTTCCCAGG - Intergenic
1017109096 6:150915625-150915647 AAGTCTCACTCTGTTGCCCAGGG + Intronic
1017458041 6:154620421-154620443 GAGTCTCGCTCTGTTGGCCAGGG - Intergenic
1019717109 7:2544227-2544249 GAGTCTTGTTCTGTTGCCCAGGG + Intronic
1019966594 7:4504206-4504228 AAGTCTCACTCTGTTGCCCAGGG - Intergenic
1020062796 7:5165152-5165174 AAGTCTCGTTCTTGTCCCCCAGG - Intergenic
1020122368 7:5512216-5512238 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1020145318 7:5637870-5637892 AAGTCTTGTTCTGTTGTCCTGGG + Intronic
1020149150 7:5668247-5668269 GAGTCTCGCTCCGTTGGCCCCGG + Intronic
1020196466 7:6043453-6043475 CAGTCTCGCTCTGTTGCCCAGGG + Intronic
1020203856 7:6100707-6100729 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
1020264013 7:6548321-6548343 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1020321270 7:6940324-6940346 CAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1020992664 7:15220242-15220264 GAGTCTGGATCTGTTGCCCCAGG + Intronic
1021881253 7:25097407-25097429 AAGTCTCGCTCTTTTCCCCCAGG + Intergenic
1022162201 7:27722533-27722555 AAGTCTCGCTCTTGTCTCCCGGG + Intergenic
1023441922 7:40193309-40193331 GAGTCTCACTCTGTTGCCCCAGG + Intronic
1023474398 7:40561716-40561738 GAGTCTCGTTCTGTTGCCCAGGG + Intronic
1024740914 7:52353538-52353560 AAGTCTCGTTCTCATCCCCCAGG + Intergenic
1024899189 7:54298249-54298271 AAGGCTGGTTCTGATGTGCCAGG + Intergenic
1025169856 7:56746792-56746814 AAGTCTCGTTCTATCGCCCAGGG + Intergenic
1025612778 7:63092783-63092805 AAGTCTCGCTCTTTTCCCCCAGG - Intergenic
1025702034 7:63828922-63828944 AAGTCTCATTCTATCGTCCAGGG - Intergenic
1025747830 7:64259899-64259921 AAGTCTCACTCTGTTGCCCAGGG - Intronic
1025767012 7:64464807-64464829 AAGTCTCGCTCTTGTCTCCCAGG - Intergenic
1025958247 7:66199114-66199136 AAGTGTCCTCCTGTTCTCCCTGG + Intergenic
1026439457 7:70431420-70431442 AAGTCTCGCTCTGTTGCCCAGGG + Intronic
1026442947 7:70459833-70459855 CAGTCTGGCTCTGTTGTCCTTGG - Intronic
1026645338 7:72162710-72162732 GAGTCTTGTTCTGTTGCCCAAGG - Intronic
1026919924 7:74147932-74147954 GAGTCTCGCTCTGTTGCCCACGG + Intergenic
1027026452 7:74855455-74855477 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1027055589 7:75047290-75047312 AGGTCTTGTTCTGTTGCCCCCGG + Intronic
1027061303 7:75088659-75088681 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1028092225 7:86717150-86717172 AAGTCTGGTTCTCTTATCACTGG + Intronic
1028953803 7:96666304-96666326 GACTCTAGTTCTGTTGTCCATGG - Intronic
1029023925 7:97394415-97394437 GAGTCTCGCTCTGTTGGCCCAGG + Intergenic
1029121534 7:98271309-98271331 GAGTCTCGCTCTGTTGCCCAAGG + Intronic
1029359799 7:100080466-100080488 AGGTCTTGCTCTGTTGCCCCCGG - Intronic
1029446890 7:100618417-100618439 GAGTCTCGCACTGTTGCCCCAGG - Intergenic
1029698583 7:102231054-102231076 GAGTCTCGCTCTGTTGCCCAGGG + Intronic
1029910749 7:104144728-104144750 GTGTCTCGTTCTGTTGCCCAGGG - Intronic
1030415789 7:109241100-109241122 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
1030822895 7:114117246-114117268 GAGTCTCACTCTGTTGTCCAGGG + Intronic
1032412529 7:131707779-131707801 AAGTCTCGCTCTTGTCTCCCAGG + Intergenic
1032849253 7:135779477-135779499 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
1033474636 7:141679684-141679706 AAGTTTCGCTCTTGTGTCCCAGG - Intronic
1033809893 7:145000584-145000606 AAGTCTTGCTATGTTTTCCCAGG + Intergenic
1034576876 7:152007442-152007464 GAGTCTGGCTCTGTCGTCCCAGG + Intronic
1034634376 7:152555601-152555623 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1034832877 7:154324884-154324906 GAGTCTTGCTCTGTTGCCCCTGG + Intronic
1034975274 7:155445165-155445187 AAGTCAGGTTCTGCTGTCCAAGG - Intergenic
1034986236 7:155517122-155517144 CAGTCTCATTCTGAGGTCCCGGG - Intronic
1035928702 8:3757821-3757843 AAGTCTCGCTCTTTTCACCCAGG - Intronic
1036162646 8:6404267-6404289 GAGTCTCGCTCTGTTGCCCCAGG + Intergenic
1036193754 8:6695658-6695680 AAGTCTCACTCTGTTGCCCAGGG - Intergenic
1036573795 8:10005335-10005357 GAGTCTCATTCTGTTGCCCAGGG - Intergenic
1036799607 8:11780404-11780426 GAGTCTTGCTCTGTTGGCCCAGG + Intronic
1037030746 8:14101917-14101939 GAGTCTCGCTCTGTCGCCCCAGG + Intronic
1037393386 8:18417760-18417782 GAGTCTCGCTCTGTTTGCCCAGG + Intergenic
1037445230 8:18958945-18958967 GAGTCTTGTTCTGTTGCCCAGGG + Intronic
1037666123 8:20971685-20971707 AAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1037808388 8:22071120-22071142 GAGTCTCACTCTGTTGCCCCAGG + Intronic
1038230047 8:25691304-25691326 AAGTCTCGTTCTTGTCCCCCAGG + Intergenic
1038326072 8:26573640-26573662 CAGTCTTGCTCTGTTGCCCCAGG - Intronic
1039352661 8:36779763-36779785 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1039450853 8:37674048-37674070 GAGTCTCGCTCTGTTGTCCAGGG + Intergenic
1040508970 8:48076762-48076784 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1041054426 8:53968751-53968773 GAGTCTTGTTCTGTGGCCCCGGG - Intronic
1041856810 8:62465996-62466018 GACTCTCGCTCTGTTGCCCCAGG - Intronic
1041904063 8:63012512-63012534 GAGTCTCGTTCTGTCACCCCAGG - Intergenic
1043459858 8:80448882-80448904 AGGTCTCGCTCTGTTGCCCAGGG - Intergenic
1043965040 8:86464706-86464728 AAGTTTTGCTGTGTTGTCCCAGG + Intronic
1044649983 8:94483904-94483926 AACTCTTGCTCTGTTGTCCAGGG - Intergenic
1045276311 8:100708850-100708872 GAGTCTCGCTCTGTTGCCCCAGG - Intronic
1045289003 8:100815937-100815959 GAGTCTCGCTCTGTTGCCCAGGG + Intergenic
1045555305 8:103209343-103209365 GAGTCTCGCTCTGTTGCCCAGGG - Intronic
1046128190 8:109936841-109936863 AGGTCTTGCTCTGTTGTCCAGGG + Intergenic
1046364640 8:113210850-113210872 GAGTCTTGCTCTGTTGCCCCTGG - Intronic
1047889692 8:129293981-129294003 GAGTCTCGCTCTGTCCTCCCAGG - Intergenic
1047946890 8:129889060-129889082 AAGTCTAGCTCTGTTGCCCATGG - Intronic
1048413283 8:134198079-134198101 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1048887402 8:138919378-138919400 AAGTCTCCTTCTGAAGTCTCTGG + Intergenic
1048962341 8:139590942-139590964 AAGTCCTGCTCTGTTGTCCAGGG - Intergenic
1049837302 8:144745028-144745050 GAGTCTCGTTCTGGTCACCCAGG - Intronic
1050344357 9:4671676-4671698 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1050552619 9:6761026-6761048 GAATCTCGCTCTGTTGTCCATGG + Intronic
1051139052 9:13957754-13957776 AAGTCTCATTATGTTGGCCCAGG - Intergenic
1051619862 9:19039752-19039774 AAGTCTCGTTCTTGTCCCCCAGG + Intronic
1052258300 9:26485348-26485370 GAGTCGCGCTCTGTTGCCCCAGG + Intergenic
1052288318 9:26813146-26813168 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1052482337 9:29047014-29047036 CAGTCTTGTTCTGTTGCCCAGGG - Intergenic
1052527437 9:29636695-29636717 AAGTCTCCCACTGTGGTCCCCGG - Intergenic
1052534895 9:29733720-29733742 GAGTCTCACTCTGTTGTCCAGGG - Intergenic
1052765522 9:32636030-32636052 AAGTCTTGCTCTGTCGCCCCAGG + Intergenic
1052811775 9:33067522-33067544 AAGTCTCGCTCTTGTCTCCCAGG + Intronic
1053220752 9:36311066-36311088 AAGTCTCGCTCTTTTCCCCCAGG + Intergenic
1053478630 9:38400005-38400027 GGGTCTCATTCTGTTGTCCAGGG + Intergenic
1054791269 9:69259126-69259148 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1055091520 9:72368254-72368276 GAGTCTCGCTCTGTTATCCCAGG - Intergenic
1056148136 9:83755828-83755850 AAGTCTCGATCTTATCTCCCAGG + Intronic
1056150505 9:83782690-83782712 AAGTCTCACTCTGTTGTCCCAGG + Intronic
1056378622 9:86037410-86037432 CAGTCTCGCTCTGTCGCCCCAGG - Intronic
1056566161 9:87774550-87774572 AAGTCTCGCTCTTGTCTCCCAGG + Intergenic
1057027373 9:91745149-91745171 AAGTCTCGCTCTTTTTGCCCAGG + Intronic
1057777424 9:98022213-98022235 GAGTCTCGTTCTTGTGGCCCAGG + Intergenic
1057972092 9:99568102-99568124 CAGTCTCACTCTGTTGGCCCAGG - Intergenic
1058155644 9:101511730-101511752 AAGTCTGTTTCTGTTCTTCCTGG + Intronic
1058668316 9:107340251-107340273 GAGTCTCGCTCTGTTGCCCGGGG - Intergenic
1058692805 9:107533554-107533576 AAGCCTCCTTCTGTTGTCGATGG - Intergenic
1060129346 9:121079888-121079910 AAGTCTCACTCTGTTGCCCAGGG + Intronic
1060263612 9:122096082-122096104 GAGTCTCGCTCTGTTGCCCTAGG - Intergenic
1061124952 9:128668787-128668809 GAGTCTCGCTCTGTTTTCCAGGG - Intergenic
1061426977 9:130505709-130505731 GAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1061775432 9:132959959-132959981 AAGTCACGTTCTGCGGTTCCAGG + Intronic
1062244803 9:135560479-135560501 AAGTCTTGCTCTGTTGCCCAGGG - Intergenic
1062484503 9:136768526-136768548 GAGTCTCGCTCTGTCGCCCCAGG + Intergenic
1062519394 9:136951445-136951467 GAGTCTCGCTATGTTGTCCAGGG + Intronic
1062647211 9:137554487-137554509 GAGTCTTGCTCTGTTGCCCCTGG + Intergenic
1185628804 X:1501383-1501405 AGGTCTTGCTCTGTTGCCCCAGG + Intronic
1185758571 X:2672110-2672132 AGGTCTCATTCTGAAGTCCCTGG - Intergenic
1185762095 X:2696424-2696446 AAGTCTCGCTCTTTTTCCCCAGG + Intronic
1186049353 X:5573886-5573908 AGGTCTTGCTCTGTTGTCCGGGG - Intergenic
1186076322 X:5883150-5883172 AATTCTCATTCTGTTGCCCAGGG - Intronic
1188184614 X:27098586-27098608 AAATCGCATTCTGTTGCCCCAGG - Intergenic
1188667679 X:32844378-32844400 GAGTCTCGCTCTTCTGTCCCAGG - Intronic
1188695267 X:33182462-33182484 AGGTCTCACTCTGTTGTCCAGGG + Intronic
1189508219 X:41634536-41634558 AAGTCTGATTCTGTGGCCCCGGG + Intronic
1191636991 X:63389902-63389924 GAGTCTTGCTCTGTTGCCCCAGG + Intergenic
1192106191 X:68319708-68319730 AAGTCTCATTCTGGTCTCTCAGG - Intronic
1192124742 X:68491493-68491515 GAGTCTCACTCTGTTGCCCCAGG + Intergenic
1192466946 X:71363973-71363995 AAGTCTCACTCTGTTGCCCAGGG - Intergenic
1192467065 X:71364838-71364860 TAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1192483018 X:71501035-71501057 AAGTCTCGTTCTTGTCCCCCAGG - Intronic
1192750382 X:73984422-73984444 AAGTCTCGTTCTTGTCCCCCAGG + Intergenic
1193660640 X:84253317-84253339 AAGTCCCTTTCTGTTTTCACAGG + Intergenic
1193754854 X:85395660-85395682 AAGTCTCGCTCTTGTTTCCCAGG - Intergenic
1193952720 X:87821009-87821031 GAGTCTCACTCTGTTGCCCCAGG - Intergenic
1195097326 X:101515563-101515585 AAGTCTCACTCTGTTGCCCAGGG + Intronic
1195413714 X:104597316-104597338 GAGTCTCACTCTGTTGCCCCAGG - Intronic
1195902200 X:109810907-109810929 AAGTCTTGCTCTGCTGTCCATGG + Intergenic
1196680191 X:118462511-118462533 AAGTCTCGCTGTGTTGCCCAGGG - Intergenic
1196767678 X:119263185-119263207 AAGTCCTGTTCTGATCTCCCAGG - Intergenic
1197221291 X:123916227-123916249 GAGTCTCGTTCTGTTGCCCAGGG - Intergenic
1198400643 X:136265048-136265070 GAGTCTCGTTCTTGTCTCCCAGG + Intergenic
1198827631 X:140715566-140715588 AAGTCTCACTCTGTTGCCCAAGG - Intergenic
1199395725 X:147335377-147335399 GAGTCTCGCTCTGTTGCCCCAGG - Intergenic
1199915487 X:152335746-152335768 GAGTCTCTTTCTGTTTACCCAGG + Intronic
1200208769 X:154336177-154336199 GAGTCTTGCTCTGTGGTCCCAGG - Intergenic
1200222105 X:154395953-154395975 GAGTCTTGCTCTGTGGTCCCAGG + Intronic
1200404960 Y:2800572-2800594 AAGTCTTGTTCTGATGTCTTAGG + Intergenic
1200750859 Y:6942953-6942975 GTGTCTCATTCTGTTGTCCAGGG - Intronic
1201144314 Y:11054975-11054997 AAGTCTCATTCTGAGGTCCTGGG + Intergenic
1201275394 Y:12292481-12292503 CAGTCTCGCTCTGTTGCCCAGGG - Intergenic
1201354230 Y:13081397-13081419 AAGTCTCGCTCTTTTCCCCCAGG + Intergenic
1202128675 Y:21590823-21590845 AAGTTTCGATCTGTTGTCTCAGG + Intergenic