ID: 998126801

View in Genome Browser
Species Human (GRCh38)
Location 5:139629448-139629470
Sequence TAATCAAGGTTGCTACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998126801_998126804 -5 Left 998126801 5:139629448-139629470 CCAGTCTGTAGCAACCTTGATTA No data
Right 998126804 5:139629466-139629488 GATTATCTTGGAAAAGTTACAGG No data
998126801_998126805 13 Left 998126801 5:139629448-139629470 CCAGTCTGTAGCAACCTTGATTA No data
Right 998126805 5:139629484-139629506 ACAGGAGAACGTCAAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998126801 Original CRISPR TAATCAAGGTTGCTACAGAC TGG (reversed) Intergenic
No off target data available for this crispr