ID: 998126801 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:139629448-139629470 |
| Sequence | TAATCAAGGTTGCTACAGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998126801_998126804 | -5 | Left | 998126801 | 5:139629448-139629470 | CCAGTCTGTAGCAACCTTGATTA | No data | ||
| Right | 998126804 | 5:139629466-139629488 | GATTATCTTGGAAAAGTTACAGG | No data | ||||
| 998126801_998126805 | 13 | Left | 998126801 | 5:139629448-139629470 | CCAGTCTGTAGCAACCTTGATTA | No data | ||
| Right | 998126805 | 5:139629484-139629506 | ACAGGAGAACGTCAAGTGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998126801 | Original CRISPR | TAATCAAGGTTGCTACAGAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||