ID: 998128521

View in Genome Browser
Species Human (GRCh38)
Location 5:139639525-139639547
Sequence CTGGGAGTATGGAAGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998128521_998128528 1 Left 998128521 5:139639525-139639547 CCTGCTACCTTCCATACTCCCAG No data
Right 998128528 5:139639549-139639571 TCAGTCAGGGAATTCCTTCCAGG No data
998128521_998128529 2 Left 998128521 5:139639525-139639547 CCTGCTACCTTCCATACTCCCAG No data
Right 998128529 5:139639550-139639572 CAGTCAGGGAATTCCTTCCAGGG No data
998128521_998128530 12 Left 998128521 5:139639525-139639547 CCTGCTACCTTCCATACTCCCAG No data
Right 998128530 5:139639560-139639582 ATTCCTTCCAGGGTTTAACCTGG No data
998128521_998128531 13 Left 998128521 5:139639525-139639547 CCTGCTACCTTCCATACTCCCAG No data
Right 998128531 5:139639561-139639583 TTCCTTCCAGGGTTTAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998128521 Original CRISPR CTGGGAGTATGGAAGGTAGC AGG (reversed) Intergenic
No off target data available for this crispr