ID: 998128727

View in Genome Browser
Species Human (GRCh38)
Location 5:139640544-139640566
Sequence GCTGGGCCCAGTTTCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998128727_998128731 -7 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128731 5:139640560-139640582 GCCCAGCATTGCAGGCTTTCTGG No data
998128727_998128739 18 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128727_998128734 -2 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128734 5:139640565-139640587 GCATTGCAGGCTTTCTGGCCAGG No data
998128727_998128735 -1 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128735 5:139640566-139640588 CATTGCAGGCTTTCTGGCCAGGG No data
998128727_998128737 16 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128737 5:139640583-139640605 CCAGGGTGTGCCCTCATTCCTGG No data
998128727_998128738 17 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128738 5:139640584-139640606 CAGGGTGTGCCCTCATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998128727 Original CRISPR GCTGGGCCCAGTTTCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr