ID: 998128728

View in Genome Browser
Species Human (GRCh38)
Location 5:139640545-139640567
Sequence TGCTGGGCCCAGTTTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998128728_998128738 16 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128738 5:139640584-139640606 CAGGGTGTGCCCTCATTCCTGGG No data
998128728_998128735 -2 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128735 5:139640566-139640588 CATTGCAGGCTTTCTGGCCAGGG No data
998128728_998128739 17 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128728_998128731 -8 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128731 5:139640560-139640582 GCCCAGCATTGCAGGCTTTCTGG No data
998128728_998128737 15 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128737 5:139640583-139640605 CCAGGGTGTGCCCTCATTCCTGG No data
998128728_998128734 -3 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128734 5:139640565-139640587 GCATTGCAGGCTTTCTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998128728 Original CRISPR TGCTGGGCCCAGTTTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr