ID: 998128732

View in Genome Browser
Species Human (GRCh38)
Location 5:139640561-139640583
Sequence GCCAGAAAGCCTGCAATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998128732_998128739 1 Left 998128732 5:139640561-139640583 CCCAGCATTGCAGGCTTTCTGGC No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128732_998128744 20 Left 998128732 5:139640561-139640583 CCCAGCATTGCAGGCTTTCTGGC No data
Right 998128744 5:139640604-139640626 GGGGAAGATAACTCATCCATGGG No data
998128732_998128743 19 Left 998128732 5:139640561-139640583 CCCAGCATTGCAGGCTTTCTGGC No data
Right 998128743 5:139640603-139640625 TGGGGAAGATAACTCATCCATGG No data
998128732_998128737 -1 Left 998128732 5:139640561-139640583 CCCAGCATTGCAGGCTTTCTGGC No data
Right 998128737 5:139640583-139640605 CCAGGGTGTGCCCTCATTCCTGG No data
998128732_998128738 0 Left 998128732 5:139640561-139640583 CCCAGCATTGCAGGCTTTCTGGC No data
Right 998128738 5:139640584-139640606 CAGGGTGTGCCCTCATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998128732 Original CRISPR GCCAGAAAGCCTGCAATGCT GGG (reversed) Intergenic
No off target data available for this crispr