ID: 998128733

View in Genome Browser
Species Human (GRCh38)
Location 5:139640562-139640584
Sequence GGCCAGAAAGCCTGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998128733_998128739 0 Left 998128733 5:139640562-139640584 CCAGCATTGCAGGCTTTCTGGCC No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128733_998128737 -2 Left 998128733 5:139640562-139640584 CCAGCATTGCAGGCTTTCTGGCC No data
Right 998128737 5:139640583-139640605 CCAGGGTGTGCCCTCATTCCTGG No data
998128733_998128743 18 Left 998128733 5:139640562-139640584 CCAGCATTGCAGGCTTTCTGGCC No data
Right 998128743 5:139640603-139640625 TGGGGAAGATAACTCATCCATGG No data
998128733_998128738 -1 Left 998128733 5:139640562-139640584 CCAGCATTGCAGGCTTTCTGGCC No data
Right 998128738 5:139640584-139640606 CAGGGTGTGCCCTCATTCCTGGG No data
998128733_998128744 19 Left 998128733 5:139640562-139640584 CCAGCATTGCAGGCTTTCTGGCC No data
Right 998128744 5:139640604-139640626 GGGGAAGATAACTCATCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998128733 Original CRISPR GGCCAGAAAGCCTGCAATGC TGG (reversed) Intergenic
No off target data available for this crispr