ID: 998128739

View in Genome Browser
Species Human (GRCh38)
Location 5:139640585-139640607
Sequence AGGGTGTGCCCTCATTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998128729_998128739 16 Left 998128729 5:139640546-139640568 CCAGCAGAAACTGGGCCCAGCAT No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128733_998128739 0 Left 998128733 5:139640562-139640584 CCAGCATTGCAGGCTTTCTGGCC No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128727_998128739 18 Left 998128727 5:139640544-139640566 CCCCAGCAGAAACTGGGCCCAGC No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128732_998128739 1 Left 998128732 5:139640561-139640583 CCCAGCATTGCAGGCTTTCTGGC No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data
998128728_998128739 17 Left 998128728 5:139640545-139640567 CCCAGCAGAAACTGGGCCCAGCA No data
Right 998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998128739 Original CRISPR AGGGTGTGCCCTCATTCCTG GGG Intergenic
No off target data available for this crispr