ID: 998129017

View in Genome Browser
Species Human (GRCh38)
Location 5:139641880-139641902
Sequence CACCTCAATCCAGGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998129017_998129026 5 Left 998129017 5:139641880-139641902 CCTCCTTCCCCTGGATTGAGGTG No data
Right 998129026 5:139641908-139641930 CACAGGAGGCCAGCCAGCTCAGG No data
998129017_998129025 -9 Left 998129017 5:139641880-139641902 CCTCCTTCCCCTGGATTGAGGTG No data
Right 998129025 5:139641894-139641916 ATTGAGGTGGGTGACACAGGAGG No data
998129017_998129030 29 Left 998129017 5:139641880-139641902 CCTCCTTCCCCTGGATTGAGGTG No data
Right 998129030 5:139641932-139641954 CCAGATCCCCTCTCTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998129017 Original CRISPR CACCTCAATCCAGGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr