ID: 998130411

View in Genome Browser
Species Human (GRCh38)
Location 5:139648796-139648818
Sequence CGGCCTCGCGGCGACGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 393}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998130399_998130411 -8 Left 998130399 5:139648781-139648803 CCCGCCCCTCCCCCTCGGCCTCG 0: 1
1: 1
2: 12
3: 114
4: 1745
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393
998130393_998130411 17 Left 998130393 5:139648756-139648778 CCCAGAGCGGAGCGCAGCTCCCT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393
998130395_998130411 -2 Left 998130395 5:139648775-139648797 CCCTGCCCCGCCCCTCCCCCTCG 0: 1
1: 1
2: 27
3: 352
4: 2380
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393
998130400_998130411 -9 Left 998130400 5:139648782-139648804 CCGCCCCTCCCCCTCGGCCTCGC 0: 1
1: 1
2: 17
3: 255
4: 1638
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393
998130396_998130411 -3 Left 998130396 5:139648776-139648798 CCTGCCCCGCCCCTCCCCCTCGG 0: 1
1: 2
2: 29
3: 295
4: 2113
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393
998130394_998130411 16 Left 998130394 5:139648757-139648779 CCAGAGCGGAGCGCAGCTCCCTG 0: 1
1: 0
2: 2
3: 11
4: 260
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393
998130398_998130411 -7 Left 998130398 5:139648780-139648802 CCCCGCCCCTCCCCCTCGGCCTC 0: 1
1: 0
2: 32
3: 296
4: 2472
Right 998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG 0: 1
1: 1
2: 3
3: 44
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998130411 Original CRISPR CGGCCTCGCGGCGACGGCGG CGG Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901526015 1:9823867-9823889 CAGCGTCACGGCGGCGGCGGCGG - Exonic
902323649 1:15684502-15684524 CGGCGGCGGGGCGGCGGCGGCGG + Exonic
902323650 1:15684505-15684527 CGGCGGGGCGGCGGCGGCGGTGG + Exonic
902783130 1:18717043-18717065 AGGCGCGGCGGCGACGGCGGCGG - Intronic
902823251 1:18956262-18956284 CCGCCGGGCGGCGGCGGCGGGGG - Exonic
903907300 1:26696201-26696223 CGGGCTGGCGGCGGCGGAGGAGG - Exonic
904181309 1:28668737-28668759 CGGCCTGGCGGCGGCGGTGGCGG + Intronic
904500201 1:30908786-30908808 CGGCCCGGCGGCGGCGGCGGCGG - Intergenic
904642014 1:31938140-31938162 CGGCCCGGCGGCGGCGGCGGCGG + Exonic
904720061 1:32500824-32500846 CCTCCTGGCGGCGGCGGCGGCGG + Intronic
906203532 1:43975024-43975046 CGTCATGGCGGCGACGGCGGCGG - Exonic
906319724 1:44808536-44808558 CTGGCTGGCGGCGGCGGCGGCGG - Exonic
906960916 1:50419094-50419116 AGGCCCCCCGGCGGCGGCGGCGG + Exonic
907053507 1:51345078-51345100 GCCCCTCGCGGCGGCGGCGGCGG + Exonic
907540872 1:55214887-55214909 GGCCCGCGGGGCGACGGCGGAGG - Exonic
907767382 1:57424203-57424225 CGGCCCGGCGGCGGCGGCCGGGG - Intronic
911498829 1:98661686-98661708 CGGGCTGGCGGCGGCGGTGGCGG + Intronic
912793392 1:112674896-112674918 GGGCATCGCGGCGGCGGCTGCGG - Exonic
914725190 1:150321484-150321506 CGGCGTGGCGGCGGCGGTGGCGG + Exonic
915393272 1:155562880-155562902 GGGGCTGGCGGCGGCGGCGGCGG - Intergenic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
923171663 1:231422307-231422329 CGGCCCCGCGGCGACCCGGGCGG + Exonic
924754789 1:246931497-246931519 TGGACCCGCGGCGGCGGCGGCGG - Intronic
1062874127 10:931591-931613 CGAGCTGGCGGCGGCGGCGGCGG + Exonic
1063664098 10:8051503-8051525 GGGCCCTGCGGCGGCGGCGGCGG + Intergenic
1065140432 10:22714347-22714369 CGGCCTCGGGAGCACGGCGGTGG - Exonic
1065186466 10:23174384-23174406 CCGCCTCGCGGCGACGCGAGCGG - Intergenic
1065188873 10:23192970-23192992 CGGCGGCGCGGCGCCGGCGGCGG + Exonic
1065557465 10:26931294-26931316 AGGCCTCTTGGCGACCGCGGGGG + Intergenic
1066464502 10:35640786-35640808 CCAGCTCGCGGCGGCGGCGGTGG - Exonic
1070877386 10:79826378-79826400 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
1073048714 10:100654767-100654789 GAGTCGCGCGGCGACGGCGGCGG - Intergenic
1073106029 10:101032415-101032437 GGGCCCGGCGGCGACAGCGGAGG + Exonic
1073251028 10:102120417-102120439 GGGGCGCTCGGCGACGGCGGCGG - Exonic
1073325575 10:102642674-102642696 CTTCCTCGCGGCGGCGGCGAGGG + Intergenic
1073432174 10:103493932-103493954 CCGCCCCGCGGAGACGGCCGCGG - Intergenic
1074169719 10:110919951-110919973 CGGGCCTGCGGCGGCGGCGGCGG + Intronic
1075748428 10:124743978-124744000 GGGCCGGGCGGCGGCGGCGGTGG - Intronic
1076792880 10:132786106-132786128 CGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1076930505 10:133528842-133528864 CGGCCTCTCGGCGACTGTGCGGG + Intronic
1077916024 11:6612039-6612061 CAGCCCCGCGGGGACAGCGGGGG - Exonic
1078729605 11:13963199-13963221 CGACCTCGCGGTGCCGGAGGAGG + Intronic
1079689407 11:23403539-23403561 CCGTCCCGCGGCGGCGGCGGCGG - Intergenic
1080503669 11:32892854-32892876 GGGACTCGCGGCGACGGCGGCGG - Intergenic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1083617964 11:64035775-64035797 TCCCCTCGCGGCGGCGGCGGCGG - Intronic
1083659803 11:64246777-64246799 CGGCTCCGCGGCGAGGGCGGCGG + Exonic
1085205832 11:74731371-74731393 CGGCGGCGCGGCGGCCGCGGAGG + Intronic
1087014625 11:93543241-93543263 CGGCGCGGCGGCGGCGGCGGCGG - Intronic
1090238284 11:125165153-125165175 CGGCGAGGCGGCGGCGGCGGCGG - Intronic
1090817783 11:130314439-130314461 CGGCGAGGCGGCGGCGGCGGCGG + Exonic
1091571518 12:1691075-1691097 CGGCATCGCGGCGGCGGCAGCGG + Exonic
1092256314 12:6928249-6928271 CGCCGCCGCGACGACGGCGGCGG - Intronic
1094470279 12:30796236-30796258 CGGCCGCGGGGCGGCGGGGGCGG - Intergenic
1095349048 12:41188347-41188369 CCGTCTCGCGGCGGCGGCAGTGG - Intergenic
1096148711 12:49295765-49295787 CGACCTCGCCTCGACGGCAGCGG - Intronic
1096204187 12:49707341-49707363 GGGGCGCGCGGCGAGGGCGGAGG + Exonic
1096372880 12:51083439-51083461 GGGCCCCGCGGCGACGGCCGGGG + Exonic
1096649368 12:53054344-53054366 GGGCCGCGCGGGGAAGGCGGCGG - Exonic
1096983736 12:55743394-55743416 GGGCCCCGCGGCGGCGGCGGCGG + Exonic
1097057425 12:56258295-56258317 CGAGCTCCCGGCGGCGGCGGCGG + Exonic
1098161156 12:67649041-67649063 CGGCCGGGAGGCGGCGGCGGCGG + Exonic
1098426088 12:70366619-70366641 CTGTCGCGCGGCGGCGGCGGTGG + Exonic
1098550377 12:71755150-71755172 CGGCGGCGGGGCGGCGGCGGCGG + Exonic
1098943037 12:76559439-76559461 CGGCGCCGCGGCGACCTCGGAGG - Exonic
1101935358 12:109052617-109052639 CGGTCCGGCGGCGGCGGCGGCGG + Exonic
1102197160 12:111033985-111034007 CGGCGGCGCGGCGGCGGCGAGGG + Intergenic
1102853956 12:116277502-116277524 CGGCTCCGAGGCGGCGGCGGCGG - Intergenic
1102854054 12:116277795-116277817 CGGAGTGGCGGCGGCGGCGGCGG + Intergenic
1104961580 12:132490618-132490640 CGGCCTCCCGGCGCCGGCCACGG - Exonic
1105472068 13:20703732-20703754 CCGGCTCGGGGCGGCGGCGGCGG + Intronic
1105975402 13:25468610-25468632 CGACCGCGCGGGGACGGCGGGGG - Intronic
1107467841 13:40665930-40665952 CGGCTCCGTGGCGGCGGCGGTGG - Exonic
1108408423 13:50125816-50125838 AGGCTTCGTGGCGGCGGCGGCGG + Intronic
1108541497 13:51451735-51451757 CGGCCCGGCAGCGGCGGCGGCGG - Intronic
1112752477 13:102596942-102596964 CGGCCTCGGGCCGGAGGCGGGGG - Intergenic
1113200990 13:107867321-107867343 CGGCCCTGCGGCAGCGGCGGCGG - Intergenic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1114073423 14:19132823-19132845 AAGCCTGGCGGCGAGGGCGGAGG + Intergenic
1114612520 14:24052097-24052119 CGGCTCCCCGGCGGCGGCGGCGG + Exonic
1115761314 14:36581065-36581087 CAGCCGTGCGGCGGCGGCGGCGG - Exonic
1116916737 14:50532540-50532562 CGTCCTCTCGGGGGCGGCGGAGG + Exonic
1117675607 14:58152148-58152170 GGGCCCTGCGGCGGCGGCGGCGG + Exonic
1117941590 14:60972461-60972483 GGGCATGGCGGCGGCGGCGGCGG + Exonic
1118575921 14:67241285-67241307 CGGTCTCGCGGCGGCCGCAGGGG + Exonic
1119410311 14:74426155-74426177 GGGCTGCGCGGCGGCGGCGGCGG - Intergenic
1120168029 14:81220939-81220961 CTGTCTCTCGGCGGCGGCGGCGG - Intronic
1121050441 14:90816334-90816356 GGGCGCCGCGGCGGCGGCGGTGG - Exonic
1122183501 14:99971995-99972017 CGACCCGGCGGCGGCGGCGGCGG - Intronic
1122221236 14:100240063-100240085 CGGGGGCGCGGCGGCGGCGGCGG + Intronic
1122878119 14:104678110-104678132 CGCCCACCCGGCGACGGCAGAGG + Intergenic
1122975371 14:105168674-105168696 CCACCCGGCGGCGACGGCGGCGG + Exonic
1124745964 15:32342560-32342582 CGGCCTCGCGGGGCAGGAGGAGG - Intergenic
1124966727 15:34437428-34437450 CGGCGGCGCGGCGAGGACGGCGG - Intronic
1124966731 15:34437445-34437467 CGGCGGCGCGGCGAGGACGGCGG - Intronic
1124966735 15:34437462-34437484 CGGCGGCGCGGCGAGGACGGCGG - Intronic
1124966739 15:34437479-34437501 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966743 15:34437496-34437518 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966747 15:34437513-34437535 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966751 15:34437530-34437552 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966755 15:34437547-34437569 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966759 15:34437564-34437586 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966763 15:34437581-34437603 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966767 15:34437598-34437620 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966771 15:34437615-34437637 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966775 15:34437632-34437654 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966779 15:34437649-34437671 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966783 15:34437666-34437688 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1124966787 15:34437683-34437705 CGGCGGCGCGGCGAGGACGGCGG - Intergenic
1125536063 15:40441607-40441629 CGGCCGGGCGGCGGCGGCGCGGG + Intronic
1126767003 15:52019440-52019462 GGGCCCGGCGGCGGCGGCGGCGG + Intronic
1127606510 15:60592472-60592494 CGGCGGCGCGGCGGCGGCAGAGG - Intronic
1128028575 15:64460585-64460607 CCGGATCGCGGCGGCGGCGGCGG + Intergenic
1128425959 15:67542742-67542764 CGGACTGGCGGCGGCTGCGGCGG - Exonic
1129260769 15:74365988-74366010 CGGCCCCGCGGAGGCGGCGGCGG - Intronic
1130370802 15:83284336-83284358 CGGCCGGGAGGCGGCGGCGGGGG - Intronic
1131144429 15:90002013-90002035 AAGCGTCGCGGCGGCGGCGGCGG + Intronic
1131827009 15:96330393-96330415 CCCCCTCTCGGCGGCGGCGGCGG + Intronic
1132580081 16:680692-680714 CGCCCGCGCGGGGAGGGCGGCGG + Intronic
1132815842 16:1826289-1826311 CGGTCTCGCGGCGCCGCCTGCGG - Intronic
1133784414 16:8963571-8963593 GGGCCCCGCGGCGGCGGCGGCGG - Intronic
1134143604 16:11742758-11742780 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1135321669 16:21501840-21501862 CGGCTGAGCGGCGGCGGCGGCGG - Intergenic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1136365217 16:29806488-29806510 GAGCGCCGCGGCGACGGCGGCGG - Intronic
1136449257 16:30343401-30343423 GGGCTTCGCGGAGAAGGCGGAGG + Intergenic
1136546533 16:30958018-30958040 CGGCCCCGCAGCGGTGGCGGCGG - Intronic
1136585226 16:31180235-31180257 AGGGCGCGAGGCGACGGCGGCGG + Intronic
1137988717 16:53131322-53131344 CGGCCGAGCAGCGGCGGCGGCGG - Intronic
1138450775 16:57092569-57092591 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
1139954216 16:70685679-70685701 CGGGCGCGCGGCGACGGGTGCGG - Intronic
1141054615 16:80804016-80804038 CGAGCCCGCGGCGGCGGCGGCGG - Intronic
1141079203 16:81035956-81035978 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1142336095 16:89490345-89490367 CGGCAAGGCGGCGGCGGCGGCGG + Exonic
1143527262 17:7479695-7479717 CCTCCTCTCGGCGGCGGCGGCGG - Intronic
1143590886 17:7885329-7885351 CGGGGTGGCGGCGGCGGCGGCGG - Intronic
1144656953 17:17042823-17042845 CGGCGCGGCGGCGACGGCGGCGG - Exonic
1145243590 17:21253277-21253299 CTGCGGCGCGGCGCCGGCGGGGG + Exonic
1146132629 17:30291950-30291972 CGGCTCGGCGGCGGCGGCGGCGG + Exonic
1146255982 17:31391772-31391794 AGGGCGCGCGGCGATGGCGGCGG + Exonic
1147141882 17:38464920-38464942 GGGCCTCGCCGCGTCGGTGGTGG - Intronic
1147179464 17:38674978-38675000 CGGGCTCGCGGCCCCGGCGCTGG - Exonic
1147307404 17:39573634-39573656 CGGCCCGGCGGCGGCGGCGGCGG - Intergenic
1147792497 17:43022188-43022210 CGGCGAGGCGGCGGCGGCGGCGG + Exonic
1149840973 17:59964723-59964745 CAGCCCGGCGGCAACGGCGGCGG + Intronic
1150373584 17:64662149-64662171 CGGCCGCGAGGAGGCGGCGGGGG - Intergenic
1150643478 17:66964663-66964685 CGGGCTGGCGGCGGCGGCCGGGG - Intergenic
1151780272 17:76240665-76240687 GGGCCTCGCGGCGGGGGCGTGGG + Intergenic
1152222185 17:79074976-79074998 CGGCTACACGGCGGCGGCGGCGG + Exonic
1152729020 17:81960936-81960958 CGGCCTTGAGGCGGCGGCGGCGG + Exonic
1155007482 18:21741476-21741498 CGGACTCTAGGCGTCGGCGGGGG - Exonic
1155054148 18:22170363-22170385 CGGCGCCGCGGGGACGCCGGTGG + Intronic
1157279041 18:46333973-46333995 CGGCCTCGCCGGAACCGCGGGGG - Intronic
1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG + Intronic
1158137596 18:54224231-54224253 GGCCTTGGCGGCGACGGCGGCGG - Exonic
1158601941 18:58863509-58863531 GGGCCGGGCGGCGGCGGCGGCGG - Intronic
1158954698 18:62526614-62526636 CGGGTGCGCGGCGGCGGCGGCGG - Intronic
1159040286 18:63318415-63318437 AGGCCCCGCGGCGGCGCCGGGGG + Exonic
1159224435 18:65514103-65514125 CAGCCTGGCGGCGAGGGAGGTGG - Intergenic
1160204601 18:76822599-76822621 CGGCCCCGCGGCATCGTCGGCGG - Intronic
1160204672 18:76822793-76822815 CGGCCAGTCGGCGGCGGCGGCGG - Intronic
1160453334 18:78979738-78979760 GGGCCGCCCGGCGGCGGCGGCGG + Intergenic
1160453338 18:78979741-78979763 CCGCCCGGCGGCGGCGGCGGGGG + Intergenic
1160592532 18:79952144-79952166 CGGCCCCCCGGCGACGGCCCCGG - Intergenic
1160873167 19:1286077-1286099 CGCCCGCTCGGCGGCGGCGGCGG + Intergenic
1160943156 19:1629446-1629468 AGGCCTCGGGGCTACGGAGGGGG + Intronic
1161022137 19:2015533-2015555 CGGCCCAGGGGCGGCGGCGGCGG + Exonic
1161165158 19:2782979-2783001 CGGCCTGGTGGCGAGGACGGCGG - Intronic
1161333813 19:3700390-3700412 TGGCCGCGCGCGGACGGCGGCGG + Exonic
1161628763 19:5340882-5340904 CGACCCGGCGGCGGCGGCGGCGG - Intergenic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1162312434 19:9914854-9914876 CGGGCTGAGGGCGACGGCGGCGG - Intronic
1163316194 19:16542230-16542252 CGGCCTCGCGGCTTCGCCTGCGG - Intronic
1163390307 19:17026721-17026743 CGTCCTCGCGCCGCCGCCGGGGG + Exonic
1163606975 19:18280978-18281000 GGGCCCCCCGGCGGCGGCGGCGG + Exonic
1163609349 19:18292919-18292941 CGGCCTCGCTGGGCGGGCGGGGG - Intergenic
1165204518 19:34172451-34172473 CGGCGCGGCGGCGGCGGCGGCGG - Intergenic
1165204519 19:34172454-34172476 CCGCGGCGCGGCGGCGGCGGCGG - Intergenic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165420066 19:35718085-35718107 CGGCCGCGGGGCGCCGGCGGGGG + Exonic
1166091639 19:40513071-40513093 CGGCGGCGCGGCGAGAGCGGCGG + Exonic
1167072953 19:47231148-47231170 GCGCCTGGCGGCGGCGGCGGCGG - Intronic
1167472064 19:49680785-49680807 GGGCCTCGCGCCGAAGGCTGGGG + Intronic
1167643706 19:50695093-50695115 CGGGGACGCGGCGGCGGCGGCGG - Intronic
1168337009 19:55602637-55602659 CCGCCTCGCGGAAGCGGCGGGGG - Exonic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
1168721773 19:58558398-58558420 GGGCCCCGCGGCGGCGGCAGCGG - Exonic
926166216 2:10523272-10523294 TGGCCTCGGGGCGAGGGCAGAGG + Intergenic
927881455 2:26692704-26692726 CAGCTCCGCGGCGGCGGCGGCGG + Intronic
927956715 2:27212118-27212140 AAGCCGCGCGGCGACGGGGGAGG + Exonic
928511795 2:32010139-32010161 GGGCCAGGCGGCGACGGCGGCGG + Intronic
929501403 2:42494008-42494030 CCGGCTCGCGGCGGCGGGGGCGG + Exonic
929966887 2:46542941-46542963 CGGAGCGGCGGCGACGGCGGCGG + Exonic
932345868 2:70994836-70994858 CGGGGACGCGGCGGCGGCGGCGG - Exonic
932827929 2:74958676-74958698 CGGGATGGCGGCGGCGGCGGCGG + Exonic
933666714 2:84970832-84970854 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
933666863 2:84971288-84971310 CGCTCCCGCGGCGGCGGCGGCGG - Exonic
933847534 2:86337678-86337700 CGTTCTGGCGGCGGCGGCGGCGG + Intronic
933907959 2:86914013-86914035 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933907984 2:86914077-86914099 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908004 2:86914126-86914148 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908043 2:86914231-86914253 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908060 2:86914278-86914300 CGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908078 2:86914327-86914349 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908094 2:86914373-86914395 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908108 2:86914413-86914435 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908152 2:86914538-86914560 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908175 2:86914605-86914627 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908187 2:86914639-86914661 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908200 2:86914676-86914698 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908214 2:86914716-86914738 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908230 2:86914762-86914784 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908258 2:86914842-86914864 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908288 2:86914928-86914950 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
934011434 2:87824753-87824775 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011450 2:87824796-87824818 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011462 2:87824827-87824849 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011550 2:87825381-87825403 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011567 2:87825427-87825449 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934261195 2:91478110-91478132 CGGCACCGGGGCGGCGGCGGCGG - Intergenic
934567070 2:95346908-95346930 CGGCCTCTCGGGGGCGGCGACGG - Intronic
934638350 2:96010714-96010736 CTACCTGGCGGCGGCGGCGGCGG - Intergenic
934795305 2:97094697-97094719 CTACCTGGCGGCGGCGGCGGCGG + Exonic
934966832 2:98731021-98731043 GGGGCTCGCGGCGGCAGCGGCGG - Intronic
935592734 2:104856225-104856247 GGGCCCGGCGGCGGCGGCGGCGG + Exonic
935622958 2:105144489-105144511 AGGCCACGCGGGGACGGAGGAGG + Intergenic
936126696 2:109794576-109794598 CGGCCGGGGGGCGGCGGCGGCGG + Intronic
936954977 2:118014117-118014139 CGGGCAGGCGGCGGCGGCGGCGG - Exonic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
938018394 2:127885990-127886012 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
939153802 2:138501750-138501772 CGTGCGCGCGGCGGCGGCGGCGG - Intergenic
939432656 2:142130781-142130803 CGGCCCGGCGGCGGCGGCGGCGG + Exonic
941119114 2:161507860-161507882 TGGGCCCGCGGCGGCGGCGGCGG - Intronic
942241111 2:173964677-173964699 CCGCCCCCCGGCGGCGGCGGCGG + Intronic
942346216 2:175005258-175005280 CGCACTGGCGGCGGCGGCGGCGG + Intronic
942463965 2:176188995-176189017 CGGCCGCGCGGGGGCGGCCGGGG - Exonic
944831215 2:203535337-203535359 GCGCCCCGCGGCGGCGGCGGCGG + Exonic
945241557 2:207681464-207681486 CGGCTCCGCGGCGAGGGCGGCGG - Intergenic
945699412 2:213151710-213151732 CGGGCTGGCGGCGGCTGCGGCGG + Intronic
946340026 2:219060746-219060768 TGGCAACGCGGCGGCGGCGGGGG + Intergenic
946431018 2:219627523-219627545 CGGCCCGGCGGCGGCGGCGGCGG + Intronic
947353636 2:229271308-229271330 CGAGCGCGCGGCGGCGGCGGGGG + Intergenic
948046910 2:234952062-234952084 GGGACTCACGGCGGCGGCGGCGG - Intronic
948140475 2:235669505-235669527 CGGGAGCGCGGCGGCGGCGGCGG - Intronic
948614592 2:239190350-239190372 CGGCCTCCCGGGGAGGGTGGAGG - Intronic
948824775 2:240568867-240568889 GGGCGTCTCGGCGGCGGCGGCGG - Exonic
1168814576 20:728128-728150 CGGCCCCGCGGGGGCGGCGCAGG + Intergenic
1169093167 20:2873623-2873645 GAGCCCCGCGGCGGCGGCGGCGG - Intronic
1169214730 20:3786515-3786537 CCGCCCCGGGGCGGCGGCGGCGG - Exonic
1170150419 20:13221468-13221490 CTGCCTGGCGGCGGCGGCGGCGG - Intergenic
1170617805 20:17968483-17968505 CGCCCAGGCGGCGGCGGCGGCGG - Intronic
1170756806 20:19212488-19212510 CGGCGGCGCGGCGGGGGCGGCGG - Intergenic
1172252557 20:33490081-33490103 CGGCCTAACGGCGGCGGCGGCGG + Intronic
1172474494 20:35226781-35226803 TGGCCCGGCGGCGGCGGCGGCGG - Exonic
1172644521 20:36461529-36461551 CGGACTGGCGGCGGCGGCGGCGG - Intronic
1173454157 20:43189990-43190012 CGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1173672948 20:44810559-44810581 CCGCCTCGCGCTGCCGGCGGGGG - Intergenic
1175267059 20:57709532-57709554 CTGCCCGGCGGCGGCGGCGGCGG + Exonic
1175429527 20:58891680-58891702 CGGCCGGGCTGCGGCGGCGGCGG - Intronic
1175847232 20:62065361-62065383 GGGCCCCGCGGCGACGGCGGCGG + Exonic
1175859713 20:62143654-62143676 CGGAGGCGCGGCGACGGCGACGG + Intergenic
1176005627 20:62861057-62861079 GGGCCGCGCGGCGCGGGCGGCGG + Exonic
1176029843 20:63006654-63006676 CGGCTACGCGGCGGCGGCTGCGG - Exonic
1177011058 21:15730371-15730393 GGCCCCCGCGGCGGCGGCGGCGG - Exonic
1178103925 21:29298618-29298640 GGGCCTCGAGGAGGCGGCGGTGG - Intronic
1179209549 21:39313598-39313620 CGGTATGGCGGCGGCGGCGGCGG - Exonic
1179882668 21:44300049-44300071 CGGCGACGCGGCGCAGGCGGCGG + Exonic
1180156744 21:45981782-45981804 CGGTCTCTGGGCGGCGGCGGCGG + Exonic
1180736971 22:18024466-18024488 AGGCCGCGCGGCGAGGACGGAGG + Exonic
1180801576 22:18634449-18634471 CGGGCAGGCGGGGACGGCGGCGG - Intergenic
1180852819 22:19029988-19030010 CGGGCAGGCGGGGACGGCGGCGG - Intergenic
1181026856 22:20131830-20131852 AGGACCCGCGGCGGCGGCGGCGG - Intronic
1181220146 22:21360812-21360834 CGGGCAGGCGGGGACGGCGGCGG + Intergenic
1181478093 22:23180835-23180857 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1181639276 22:24188262-24188284 GGGCCTCGCGGTGGTGGCGGCGG + Exonic
1182576478 22:31276579-31276601 CGGCTCCGCGGCGAGGGCGGCGG - Intronic
1182663978 22:31944326-31944348 AGGCCGGGCGGCGGCGGCGGCGG + Intronic
1182771806 22:32801771-32801793 CGGCCTCCCGGCGAAGGAGCAGG - Exonic
1183966692 22:41446625-41446647 CGGACTAGCGGCGACGACGCGGG + Exonic
1184698016 22:46150536-46150558 CGGCCCCGCGGCGGGGGCAGCGG + Intronic
1184747289 22:46463740-46463762 CGCCCTCGCGGCTGCGGCAGCGG + Exonic
1185278485 22:49960108-49960130 CAGCCTCGCAGCCCCGGCGGGGG - Intergenic
1185397554 22:50600661-50600683 CGGCGGCGCGGGGAGGGCGGCGG - Intronic
1203238468 22_KI270732v1_random:30915-30937 CGCCCCGGCGGCGGCGGCGGCGG - Intergenic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
950729887 3:14947929-14947951 CGGGCTCGGGCCGGCGGCGGAGG + Intronic
950903000 3:16513712-16513734 CGGACGCGCGGCGGCGGCGGCGG - Intronic
952241198 3:31532846-31532868 CGGCCTCGCGGCGCTGAGGGCGG + Exonic
953801083 3:46023123-46023145 CGGGGTCGCGGCGGCGGCGCAGG + Intronic
954198038 3:49007812-49007834 CGGCCGCGCGGAGGCGGAGGCGG + Intronic
954202102 3:49029500-49029522 CCGCCTCGCTGCGGCGGGGGCGG + Intergenic
955911576 3:63863963-63863985 GGGTCCCGCGGCGGCGGCGGCGG - Intergenic
955916482 3:63912637-63912659 GCGCCGCGCGGCGGCGGCGGCGG + Exonic
956678014 3:71753641-71753663 GGGCTCCGCGGCGGCGGCGGCGG + Intronic
960096718 3:113696573-113696595 CGGGCTCGCAGCGGCTGCGGTGG - Exonic
962770866 3:138609056-138609078 CGGCCCTGCTGCGCCGGCGGCGG + Intronic
962793987 3:138835001-138835023 GGGCCCCGCGGTGGCGGCGGCGG + Intergenic
963253095 3:143120073-143120095 CGACCCCGCAGCGGCGGCGGCGG - Exonic
964438081 3:156674856-156674878 CGGCCTCGCGGCTCCGGCCCCGG + Exonic
965590652 3:170357729-170357751 CGGGCGAGCGGCGACGGCGGCGG + Intronic
965590666 3:170357783-170357805 CGGCGACGCGGCGGAGGCGGCGG + Intronic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
968434126 4:576248-576270 CGGGGTCGCGGCGGCGGCGGCGG - Intergenic
968701302 4:2059405-2059427 CGGACCCGCGGCGGCGGCGGCGG - Intergenic
970202883 4:13627493-13627515 GGGCCCGGCGGCGGCGGCGGTGG + Exonic
972511531 4:39771668-39771690 CGCGCGCGCGGCGACGGCGTCGG + Intronic
972533050 4:39977566-39977588 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
975689525 4:76950028-76950050 CGGCCCCGCGGCGGCGGCGACGG + Intronic
976146125 4:82044189-82044211 CTGCCCCGCGGCTGCGGCGGAGG + Intronic
978617927 4:110614361-110614383 GGGAGTCCCGGCGACGGCGGCGG + Intergenic
980130063 4:128809966-128809988 CGGTCCCGCGGCGGCGACGGCGG + Intronic
982712208 4:158768947-158768969 CAGCCCCACGGCGGCGGCGGCGG - Intergenic
983576984 4:169270888-169270910 CGGCCCCGCAGCGGCTGCGGCGG + Exonic
984735053 4:183099970-183099992 CGGCCTCTGGGCGGCGGGGGTGG + Intronic
984917013 4:184734039-184734061 TGGCCCCGCGGGGGCGGCGGCGG - Exonic
985894269 5:2739624-2739646 GGGTCCGGCGGCGACGGCGGCGG - Intergenic
986330752 5:6714401-6714423 CGGCCGGGCGGCGGCCGCGGCGG + Intergenic
989043133 5:37249362-37249384 CTGCGTCCTGGCGACGGCGGAGG + Exonic
990955024 5:61332321-61332343 CGGCCGGGCGGCGGCGGCGGCGG + Exonic
990955149 5:61332808-61332830 GGCCCCCGCGGCGGCGGCGGCGG - Exonic
992312093 5:75511447-75511469 AGGGGTCACGGCGACGGCGGCGG - Exonic
992444216 5:76819695-76819717 CGGCCCCGCGGGGCCAGCGGAGG - Intronic
992690458 5:79236335-79236357 CGGCCTCGCGCGGGGGGCGGCGG + Exonic
995106247 5:108381036-108381058 CAGCCCCGCTGCGGCGGCGGGGG - Exonic
995512193 5:112921316-112921338 CAGCCTCGCGGTGTGGGCGGCGG - Intronic
996404228 5:123090385-123090407 CGGCTCGGCGGCGACGGCAGCGG - Exonic
997233054 5:132257649-132257671 CGGCGTCCAGGCGGCGGCGGCGG + Exonic
997521269 5:134525856-134525878 CGGGGTCGCGGCGAGGGAGGCGG - Intronic
997521547 5:134526907-134526929 CGCCCGCGGGGCGACGGCAGGGG + Intronic
997975420 5:138439127-138439149 AGGCCGAGCGGCGGCGGCGGCGG - Exonic
998095580 5:139394140-139394162 CGGCCTCGGGGCCTTGGCGGGGG + Exonic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
998583617 5:143404199-143404221 CGGCCCGGCGGCGGCGGCGCGGG - Intronic
999326937 5:150649595-150649617 CAGCCCCGCGGCGGCGGAGGAGG + Exonic
1000345800 5:160312506-160312528 CAGGGGCGCGGCGACGGCGGGGG - Exonic
1001065104 5:168529661-168529683 CGGGCGCGCGGCTTCGGCGGGGG + Exonic
1001639132 5:173232897-173232919 CGGGCAGGCGGCGGCGGCGGCGG + Exonic
1002524361 5:179807027-179807049 CCCCCTCGCGGCGCCGGCGACGG - Intronic
1002580938 5:180209135-180209157 CGGTCGGGCGGCGGCGGCGGCGG - Intronic
1003325212 6:5085591-5085613 CAGGGTGGCGGCGACGGCGGTGG + Exonic
1004044691 6:12012450-12012472 CCCCCGCGCGGCGGCGGCGGCGG - Exonic
1004262075 6:14117562-14117584 CGCGCACGCGGCGAGGGCGGCGG + Intronic
1006337419 6:33427948-33427970 CGGCCGCGCGGTGACGGCCGCGG - Intronic
1006472658 6:34237331-34237353 GGGGCCCGCGGCGGCGGCGGCGG + Intronic
1007432876 6:41786624-41786646 AGGACTCTCGGCGGCGGCGGCGG + Intronic
1007600138 6:43076272-43076294 GGGCTTGGCGGCGGCGGCGGCGG + Intronic
1007644401 6:43369304-43369326 CGGCCTAAAGACGACGGCGGGGG - Exonic
1007665357 6:43510148-43510170 CGCGGTCGCGGCGGCGGCGGCGG + Exonic
1008945291 6:57090185-57090207 GGGATTCGTGGCGACGGCGGCGG + Exonic
1010141920 6:72622249-72622271 CGGCGCAGCGGCGGCGGCGGCGG + Exonic
1012475717 6:99613529-99613551 CGGCCTAGCGAGGGCGGCGGCGG + Exonic
1012475778 6:99613752-99613774 AGGCCAGGCGGCGGCGGCGGCGG - Exonic
1012939652 6:105403127-105403149 GGGCCCAGCGGCGGCGGCGGCGG + Intergenic
1013155800 6:107490250-107490272 CGGCCCGGCGGCGGCGGCGGCGG + Exonic
1013575930 6:111483378-111483400 CGGGCACGCGGCGAGGGAGGCGG + Intronic
1014246897 6:119078807-119078829 GGGACTGGCGGCGGCGGCGGCGG - Intronic
1014913375 6:127118838-127118860 CGGGCGAGCGGCGGCGGCGGCGG - Exonic
1016739056 6:147509081-147509103 CGGCCTCCAGGATACGGCGGCGG - Exonic
1016992795 6:149941657-149941679 GGACCTCGCGGCGCAGGCGGAGG + Intergenic
1017164039 6:151391171-151391193 GCGCCTCGCGGGGGCGGCGGCGG - Intronic
1017164159 6:151391554-151391576 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017672010 6:156777815-156777837 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1017880547 6:158559987-158560009 CGGGCGCGCGGCGAGGGGGGTGG - Intronic
1019111927 6:169724009-169724031 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1019343560 7:519435-519457 CGGTGTGGCGGCGGCGGCGGCGG - Intronic
1019474250 7:1236436-1236458 CAGCCCCGCGGCGGCGGCGGCGG - Exonic
1019563186 7:1667834-1667856 TGTCCTCGCGGCGGCGGCGCCGG + Intergenic
1019563843 7:1670213-1670235 CGGCCGCGCGGCGAGGGGCGGGG + Intergenic
1019711488 7:2520026-2520048 CGGGCTGGGGGCGGCGGCGGCGG + Exonic
1020103185 7:5407070-5407092 CGGCCTCGCAGGGACGTCTGGGG + Intronic
1020288801 7:6706710-6706732 CGGCCGGGCGGTGACGACGGCGG - Exonic
1020560542 7:9726140-9726162 CGTCCTCGCGCCGCCGCCGGGGG - Intergenic
1021231101 7:18086897-18086919 CCCCCGCGCGGCGGCGGCGGCGG + Intergenic
1021521451 7:21543125-21543147 TGCGCTCGCGGCGACCGCGGAGG + Intergenic
1021827915 7:24573270-24573292 CGCCCAAGCGGCGGCGGCGGCGG + Intronic
1022427952 7:30285546-30285568 CGGCGCCGCGGCGGCCGCGGCGG + Exonic
1024579825 7:50792968-50792990 CGGGCGCGCGGCGGAGGCGGAGG - Intronic
1026765265 7:73155756-73155778 CGGCCCCGTCGCCACGGCGGGGG + Intergenic
1026817139 7:73521928-73521950 CGCCATCGCGGCGGCGGCGGTGG + Exonic
1027041739 7:74965512-74965534 CGGCCCCGTCGCCACGGCGGGGG + Intronic
1027081903 7:75236857-75236879 CGGCCCCGTCGCCACGGCGGGGG - Intergenic
1027232618 7:76281580-76281602 CGGGCAGGCGGCGGCGGCGGCGG + Exonic
1028173640 7:87628548-87628570 CGGCGGCGCGCCGAGGGCGGAGG + Exonic
1029708326 7:102286803-102286825 GGGGCTCGCGGCGGGGGCGGGGG + Intronic
1029896403 7:103989367-103989389 AGGGCGCGCGGCGGCGGCGGCGG - Exonic
1029927010 7:104328805-104328827 GAGCATCGCGGCGGCGGCGGCGG - Exonic
1032787454 7:135211755-135211777 GGTCCTGGCGGCGCCGGCGGCGG + Intergenic
1033033216 7:137846764-137846786 CGGGCTGGCGGCGGCGGCGGCGG + Exonic
1033220510 7:139523995-139524017 CGGCCTGGGGGCGGCGGGGGCGG - Exonic
1034306283 7:150047673-150047695 CGGGAGCGCGGCGGCGGCGGCGG - Intergenic
1034781612 7:153887144-153887166 CGGCCGGGCGGCGACGCCAGGGG - Intronic
1034800564 7:154052980-154053002 CGGGAGCGCGGCGGCGGCGGCGG + Intronic
1042532867 8:69833004-69833026 GGGCCCAGCGGCGGCGGCGGCGG - Exonic
1043388252 8:79768308-79768330 CGCGCTGGCGGCGGCGGCGGCGG + Intergenic
1043502788 8:80873796-80873818 CGGCGACGAGGCGGCGGCGGCGG + Intronic
1044115252 8:88327522-88327544 CGGGCTGGAGGCGGCGGCGGCGG - Intronic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1049628256 8:143636329-143636351 CAGCCTCGCGGGGGCGGCCGTGG - Intronic
1052362161 9:27573220-27573242 GGGCTTCCCGGCGGCGGCGGCGG - Intronic
1052903804 9:33817243-33817265 GGGTCTCGCGGCGGTGGCGGCGG - Intergenic
1052903990 9:33817741-33817763 GGCCATCGCGGCGGCGGCGGCGG - Exonic
1054762321 9:69014116-69014138 GGGTCTCGCGGCGGCGGCGGCGG + Intergenic
1054835653 9:69672549-69672571 CGAGCCCGCGGCGGCGGCGGCGG + Intergenic
1057245535 9:93451687-93451709 CGGCCTCGCAGCGGCGGCAGCGG + Intronic
1057259670 9:93576680-93576702 GGGCCGCGCGGGGGCGGCGGGGG - Exonic
1057463771 9:95292423-95292445 CGGGCCCGAGGCGGCGGCGGAGG - Intronic
1057489148 9:95508372-95508394 CGTCCCCGCGGCGGCGGCGGCGG - Exonic
1057922018 9:99105250-99105272 CGTGCTGGCGGCGGCGGCGGCGG + Exonic
1059483713 9:114611528-114611550 CGGGGTGGCGGCGGCGGCGGCGG + Exonic
1059633940 9:116154350-116154372 CCGCCCGGCGGCGGCGGCGGCGG - Exonic
1059769783 9:117414624-117414646 CGGGGACGCGGCGGCGGCGGCGG + Exonic
1060200939 9:121651563-121651585 CGGCCCCGCGGCGGGGGCTGGGG - Intronic
1060263167 9:122093184-122093206 CGGCGGAGCGGCGGCGGCGGCGG - Exonic
1060849189 9:126860672-126860694 TGGCCTGGCGCCGGCGGCGGCGG + Intronic
1061208509 9:129177626-129177648 GGGCTGCGCGGCGGCGGCGGCGG - Exonic
1061559754 9:131394575-131394597 CGGCCTCGGGGGTACGGGGGTGG - Intronic
1061975829 9:134067723-134067745 CGGGGTCGCGGCGGCGGTGGCGG - Intronic
1062022559 9:134326355-134326377 CGGCGCTGCGGCGCCGGCGGGGG - Intronic
1062493734 9:136821890-136821912 CGCCCTCACGGCCACGGTGGCGG - Intronic
1062507669 9:136886461-136886483 CGGCGGAGCGGCGGCGGCGGCGG + Intronic
1062560409 9:137139199-137139221 GGGCCCGGCGGCGGCGGCGGCGG - Intronic
1062653529 9:137590425-137590447 CGGGCGCGAGGCGGCGGCGGAGG - Exonic
1203773673 EBV:61493-61515 CGCCCCCGCCGCGACGGCTGTGG - Intergenic
1185641504 X:1591611-1591633 AGGGCGGGCGGCGACGGCGGTGG + Exonic
1187915767 X:24150559-24150581 CGGCGTCCGGGCGGCGGCGGTGG - Intronic
1189325562 X:40109016-40109038 CGGGAACGCGGCGGCGGCGGCGG + Intronic
1191184158 X:57592286-57592308 CAACCTAGCGGCGGCGGCGGCGG + Exonic
1193654992 X:84187994-84188016 GGGGGTCGCGGCGGCGGCGGCGG - Intergenic
1195138232 X:101931999-101932021 GCGCCTCGCTGCGATGGCGGCGG - Intronic
1195668346 X:107449906-107449928 CGGCGCAGCGGCGGCGGCGGCGG - Intergenic
1195668347 X:107449909-107449931 CGGCGGCGCAGCGGCGGCGGCGG - Intergenic
1196684025 X:118495707-118495729 CTGCCCCACGGCGTCGGCGGCGG - Intergenic
1197753417 X:129980431-129980453 CGGCCCTGCGGCGGGGGCGGGGG + Intergenic
1198683349 X:139204323-139204345 CGGGATCGCGGCGGCGGCGGCGG - Intronic
1198767123 X:140091419-140091441 GGGCATCGCGGCGGCGCCGGCGG + Intergenic
1199445104 X:147912043-147912065 CGGCAGCGCGGCGGCGGCGGCGG + Exonic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic
1200100745 X:153688278-153688300 CGGCCGGGCGGCGGCGGCGGCGG - Exonic
1200155326 X:153971958-153971980 CTGCCTCGCGGCGGGGGTGGGGG + Intergenic
1200173766 X:154097639-154097661 CGGCGCGGCGGCGGCGGCGGCGG + Exonic