ID: 998130737

View in Genome Browser
Species Human (GRCh38)
Location 5:139649937-139649959
Sequence GCGCACCCCGCGCTCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998130737_998130741 6 Left 998130737 5:139649937-139649959 CCGGCGGGGAGCGCGGGGTGCGC 0: 1
1: 0
2: 3
3: 20
4: 215
Right 998130741 5:139649966-139649988 TTGTTTATTTGTAGGATCGACGG 0: 1
1: 0
2: 1
3: 13
4: 565
998130737_998130742 23 Left 998130737 5:139649937-139649959 CCGGCGGGGAGCGCGGGGTGCGC 0: 1
1: 0
2: 3
3: 20
4: 215
Right 998130742 5:139649983-139650005 CGACGGAAAGCGAGTGACCCCGG No data
998130737_998130739 -2 Left 998130737 5:139649937-139649959 CCGGCGGGGAGCGCGGGGTGCGC 0: 1
1: 0
2: 3
3: 20
4: 215
Right 998130739 5:139649958-139649980 GCCTGGCTTTGTTTATTTGTAGG 0: 1
1: 0
2: 1
3: 34
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998130737 Original CRISPR GCGCACCCCGCGCTCCCCGC CGG (reversed) Intronic