ID: 998130739

View in Genome Browser
Species Human (GRCh38)
Location 5:139649958-139649980
Sequence GCCTGGCTTTGTTTATTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998130729_998130739 16 Left 998130729 5:139649919-139649941 CCCGGAATGGGCTGCTTTCCGGC 0: 1
1: 0
2: 0
3: 15
4: 109
Right 998130739 5:139649958-139649980 GCCTGGCTTTGTTTATTTGTAGG 0: 1
1: 0
2: 1
3: 34
4: 329
998130730_998130739 15 Left 998130730 5:139649920-139649942 CCGGAATGGGCTGCTTTCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 998130739 5:139649958-139649980 GCCTGGCTTTGTTTATTTGTAGG 0: 1
1: 0
2: 1
3: 34
4: 329
998130727_998130739 21 Left 998130727 5:139649914-139649936 CCTCGCCCGGAATGGGCTGCTTT No data
Right 998130739 5:139649958-139649980 GCCTGGCTTTGTTTATTTGTAGG 0: 1
1: 0
2: 1
3: 34
4: 329
998130737_998130739 -2 Left 998130737 5:139649937-139649959 CCGGCGGGGAGCGCGGGGTGCGC 0: 1
1: 0
2: 3
3: 20
4: 215
Right 998130739 5:139649958-139649980 GCCTGGCTTTGTTTATTTGTAGG 0: 1
1: 0
2: 1
3: 34
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998130739 Original CRISPR GCCTGGCTTTGTTTATTTGT AGG Intronic