ID: 998130742

View in Genome Browser
Species Human (GRCh38)
Location 5:139649983-139650005
Sequence CGACGGAAAGCGAGTGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998130740_998130742 1 Left 998130740 5:139649959-139649981 CCTGGCTTTGTTTATTTGTAGGA 0: 1
1: 0
2: 0
3: 25
4: 398
Right 998130742 5:139649983-139650005 CGACGGAAAGCGAGTGACCCCGG No data
998130737_998130742 23 Left 998130737 5:139649937-139649959 CCGGCGGGGAGCGCGGGGTGCGC 0: 1
1: 0
2: 3
3: 20
4: 215
Right 998130742 5:139649983-139650005 CGACGGAAAGCGAGTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998130742 Original CRISPR CGACGGAAAGCGAGTGACCC CGG Intronic