ID: 998133985

View in Genome Browser
Species Human (GRCh38)
Location 5:139665209-139665231
Sequence CTCACACACAGGCGCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998133985_998133993 24 Left 998133985 5:139665209-139665231 CCCTCTCTGCGCCTGTGTGTGAG 0: 1
1: 0
2: 2
3: 25
4: 305
Right 998133993 5:139665256-139665278 AAATTAGAACGCCGCAGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 23
998133985_998133988 0 Left 998133985 5:139665209-139665231 CCCTCTCTGCGCCTGTGTGTGAG 0: 1
1: 0
2: 2
3: 25
4: 305
Right 998133988 5:139665232-139665254 CTAATTAATCTCAGCCCCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 193
998133985_998133989 1 Left 998133985 5:139665209-139665231 CCCTCTCTGCGCCTGTGTGTGAG 0: 1
1: 0
2: 2
3: 25
4: 305
Right 998133989 5:139665233-139665255 TAATTAATCTCAGCCCCTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998133985 Original CRISPR CTCACACACAGGCGCAGAGA GGG (reversed) Intronic
901194373 1:7432266-7432288 CCCAGAAACAGGCCCAGAGAGGG + Intronic
901203465 1:7480083-7480105 CTCACACACAGGCACACACACGG - Intronic
901465245 1:9417207-9417229 CCCACGCAGAGGGGCAGAGAAGG + Intergenic
902243003 1:15101074-15101096 CCCACACTCAGACGCAGCGAGGG - Intronic
903180873 1:21604236-21604258 CACAGACACAGGCCCAGGGAGGG + Intronic
904045837 1:27607641-27607663 CCCAGACACAGGCGCACAGCGGG - Intergenic
904430545 1:30461348-30461370 CTCACACCCAGAGGCAGATAGGG + Intergenic
905012101 1:34754838-34754860 CTCCCACACAAGCCCACAGATGG + Intronic
906718481 1:47988109-47988131 CTGCCACAGAGGCCCAGAGAGGG + Intronic
906782168 1:48582446-48582468 TACACACACAGGCTGAGAGAGGG + Intronic
907179023 1:52553428-52553450 CTCACACCCACGCGGAGGGAAGG + Intronic
908894724 1:68885330-68885352 CACACACACACACACAGAGATGG - Intergenic
909743205 1:79058672-79058694 CACACACACACACACAGAGAAGG + Intergenic
910112821 1:83700799-83700821 CTCAGACCCAGGCCCTGAGAGGG + Intergenic
911719006 1:101169460-101169482 CTCACACACAAACTCAGGGAGGG - Intergenic
911993721 1:104736200-104736222 GTCACTCACAGACTCAGAGAGGG + Intergenic
916641258 1:166730478-166730500 CACACACTCAGGCACTGAGAGGG + Intergenic
917254120 1:173096330-173096352 CACACACACAGACACAGACATGG - Intergenic
917750847 1:178052010-178052032 CACACACACACACACAGAGAAGG - Intergenic
918262635 1:182809595-182809617 CCCACACACAGGTGGAGAGAAGG + Intronic
919339000 1:196279378-196279400 CTCAGACTCAGGAGGAGAGACGG + Intronic
919487169 1:198159012-198159034 CACACACACCGGCCCCGAGAAGG - Intronic
920204603 1:204282477-204282499 CTCAGACCCTGGCCCAGAGATGG - Intronic
921048560 1:211494460-211494482 CACACACACACACGCAGAGCCGG - Intergenic
921346748 1:214193920-214193942 ATCACACACTGCAGCAGAGAAGG + Intergenic
921828535 1:219701306-219701328 CTCACACACAGTTACAGAGGAGG - Intronic
922558188 1:226548913-226548935 CTCGCACAAAGACGCCGAGACGG + Exonic
922788162 1:228293903-228293925 CTGGCACCCAGGCCCAGAGAGGG - Intronic
923363183 1:233233412-233233434 CACACACACAGGAGAAGAGGAGG - Intronic
923621855 1:235586370-235586392 CACACACACACACGGAGAGATGG - Intronic
1064012108 10:11743080-11743102 CTCACACAGAGGCGCGGGGCTGG + Intronic
1064836670 10:19539911-19539933 CGCGCACACACGCGCAGTGATGG + Intronic
1067662814 10:48249269-48249291 CTCACATTCAGTCCCAGAGATGG - Intronic
1068292134 10:55016965-55016987 CACACACACAGAGGGAGAGAGGG + Intronic
1075041976 10:119115267-119115289 CTCACACACAGGCTCACACAGGG - Intronic
1075056122 10:119219803-119219825 CTCACACAGAGCCTCAGAAATGG - Intronic
1075087453 10:119423024-119423046 GTCACACACTGGGGCACAGACGG + Intronic
1076193900 10:128501280-128501302 CTCACACACAGGCGCACACATGG - Intergenic
1076541039 10:131214983-131215005 CTCACTCACAGGCGGAAACAGGG + Intronic
1078398972 11:11007556-11007578 CTCACATACAAACACAGAGAAGG - Intergenic
1078545974 11:12247215-12247237 CTCACACTCAGGGACAGGGAGGG + Intronic
1079153404 11:17922282-17922304 ATCACACACACTCACAGAGAGGG + Intronic
1080823083 11:35825555-35825577 CACACACACAGTCTCAGACAAGG + Intergenic
1081307788 11:41534758-41534780 CTCAACCACAGGAGAAGAGATGG - Intergenic
1081664847 11:44910783-44910805 CTCACAGACAGGCACAGGGGAGG + Intronic
1082004927 11:47414195-47414217 CACACTCACAGGCGCTGGGAAGG - Intronic
1082106441 11:48226729-48226751 CTCACACATGGACACAGAGAGGG - Intergenic
1082669607 11:56018038-56018060 CACACACACACACGGAGAGAGGG - Intergenic
1082867885 11:57916458-57916480 ATCACACAGAGGCCAAGAGAAGG + Intergenic
1084462903 11:69306265-69306287 CTGACCCACAGGCACAGAGTTGG + Intronic
1085040671 11:73324544-73324566 AGCAGACACAGGCCCAGAGAAGG + Intronic
1086756923 11:90576572-90576594 CACACACACAGAGACAGAGACGG + Intergenic
1087027229 11:93661669-93661691 CTCTCCCGCAGGCGCAGAAACGG + Exonic
1089068204 11:115678362-115678384 CACACACACAGAGGGAGAGAGGG + Intergenic
1089108254 11:116033418-116033440 CTCACAGTCTGGGGCAGAGATGG - Intergenic
1091626982 12:2128877-2128899 AGCACACACAAGCTCAGAGAAGG + Intronic
1091850848 12:3695589-3695611 CTCACATGCATGAGCAGAGATGG + Intronic
1096400676 12:51303693-51303715 TTCAGACACAGGAGCAAAGATGG - Intronic
1096474651 12:51900921-51900943 CTCACACACGGGCGTGGAGATGG - Intergenic
1096719489 12:53510423-53510445 CTGTCACACAGGAGCAGACAAGG - Intronic
1097002265 12:55887176-55887198 CTCACACACAGACAAAAAGATGG - Intergenic
1098743458 12:74204233-74204255 CCCTCACACATGCGCAGAAAGGG + Intergenic
1099085084 12:78235913-78235935 CACACACACACACACAGAGAGGG - Intergenic
1100909920 12:99347359-99347381 GTCACACACATGCGCAGAACAGG + Intronic
1101683960 12:106998683-106998705 CACACACACAAGCTCAGAAATGG + Intronic
1102729240 12:115093391-115093413 TTCACACACAGCGGCAGAGCTGG - Intergenic
1103284652 12:119790555-119790577 CTCACACACACGCTTAGAGAAGG - Intronic
1104430195 12:128710053-128710075 CTCAGACACAGGAGCAGATGTGG - Intergenic
1104597704 12:130131382-130131404 CTCCCAGACAGGCGGAAAGAGGG + Intergenic
1105012776 12:132766662-132766684 CCCACACACAGGCGAGCAGAGGG + Intergenic
1108579487 13:51816641-51816663 CACACACACAGGTTCAGAGAAGG - Intergenic
1110688630 13:78405017-78405039 CTTACACAGAGCCACAGAGAGGG + Intergenic
1111068319 13:83127994-83128016 CGCACACACACACACAGAGATGG + Intergenic
1112331019 13:98476960-98476982 CGCACACATATGCTCAGAGAAGG + Intronic
1112394211 13:99013728-99013750 CAGACACACAGGTGAAGAGAAGG + Intronic
1119463169 14:74829135-74829157 CACACACACAGGGGAAAAGAAGG - Intronic
1119821870 14:77623360-77623382 CTGAGCCACAGGCTCAGAGAAGG + Intergenic
1121234803 14:92384461-92384483 CTCAAGCACAGGCCCAGAGCAGG - Intronic
1122663147 14:103311275-103311297 CCAACACACAGGCGCACATATGG - Intergenic
1122762323 14:104038411-104038433 CTCACCCACAGAGGCAAAGAAGG - Intronic
1123035689 14:105471014-105471036 CGCAGACACAGACGCACAGACGG - Intergenic
1202839793 14_GL000009v2_random:111156-111178 CACACACTCAGCCGCAGTGAGGG - Intergenic
1202909172 14_GL000194v1_random:101296-101318 CACACACTCAGCCGCAGTGAGGG - Intergenic
1126045869 15:44639292-44639314 CACACACACACACACAGAGATGG + Intronic
1126869908 15:52976659-52976681 CTCACACACAGCCGCTGACCTGG + Intergenic
1128497426 15:68206400-68206422 TTTGCACACAGGCGCATAGACGG + Intronic
1129850166 15:78789289-78789311 AGCACACAGAGGCCCAGAGAGGG + Intronic
1130169546 15:81497455-81497477 CTCAGAGCCAGGCTCAGAGAGGG + Intergenic
1130237660 15:82151802-82151824 CTCACACATGGGGCCAGAGAGGG + Exonic
1130252095 15:82306287-82306309 AGCACACAGAGGCCCAGAGAGGG - Intergenic
1133651923 16:7820621-7820643 CACACACACACGCGCAAAGGGGG + Intergenic
1133769227 16:8858183-8858205 CACACACACAGGAGCACAGCTGG + Intronic
1134053456 16:11154091-11154113 TGCACACACATGCGCAGACAGGG + Intronic
1134372532 16:13638654-13638676 CTCTCTCAAAGGCACAGAGAGGG + Intergenic
1134880854 16:17744723-17744745 CGCACACACACGGACAGAGATGG + Intergenic
1136912436 16:34155288-34155310 CACACACACAGGCAGAGAAAGGG - Intergenic
1137712144 16:50573837-50573859 CTCAGCCACAGGGGCTGAGAGGG + Intronic
1138768223 16:59630045-59630067 CTCACACATATGAACAGAGATGG - Intergenic
1140375189 16:74439783-74439805 CTCTCACTCTGCCGCAGAGAAGG - Intergenic
1142034015 16:87852624-87852646 CACACACAGAGGCTCAGAGCTGG - Intronic
1142110759 16:88329842-88329864 CTCACCCACCAGAGCAGAGATGG + Intergenic
1142489593 17:269741-269763 TTCACACACAGGCACACCGAAGG - Intronic
1142513274 17:411043-411065 CTCACTCTCATGCACAGAGAAGG + Intronic
1142605558 17:1079222-1079244 CTCACACACACGCACACACAAGG + Intronic
1143288346 17:5809367-5809389 CTCACTCCAAGGCCCAGAGATGG + Intronic
1143448732 17:7023325-7023347 CTGAGACACAGGCGCGCAGAGGG + Intronic
1144457771 17:15432972-15432994 CCCACACACATGCTCAGAGCTGG + Intergenic
1144952731 17:19002974-19002996 CTCACAAAGAGGCTCAGAGAGGG + Intronic
1147919196 17:43906108-43906130 CTCCCTCACAGGGTCAGAGAAGG + Intronic
1149893243 17:60408806-60408828 CTCAGACCAAGGAGCAGAGACGG + Intronic
1151290794 17:73148378-73148400 CACACACACACACACAGAGACGG - Intergenic
1151806642 17:76409865-76409887 CAGACAGACAGACGCAGAGAAGG + Intronic
1151826951 17:76529075-76529097 CGCACACCCTGGAGCAGAGACGG + Intronic
1151955224 17:77376766-77376788 CACACACACAGGCCCACGGACGG - Intronic
1151997032 17:77616377-77616399 CACACACACCTGTGCAGAGATGG + Intergenic
1152559654 17:81071671-81071693 CTCAAACAGAGGCTCAGGGACGG - Intronic
1155372239 18:25113779-25113801 CACACACACACACACAGAGACGG + Intronic
1156672026 18:39482114-39482136 CACACACACACACACAGAGACGG - Intergenic
1157034675 18:43956995-43957017 CACACACACACACGGAGAGAAGG - Intergenic
1157213635 18:45764107-45764129 CTCACAAAGAGGCTCAGAGAGGG + Intergenic
1158400316 18:57115912-57115934 CTCACACACAGGCAAAGAGTAGG + Intergenic
1158680444 18:59561799-59561821 CTCACACACAGCTGCACAGCCGG - Intronic
1159038534 18:63300342-63300364 CACACACACATTCACAGAGAAGG + Intronic
1159457013 18:68671556-68671578 CTCACACACATGGGCATGGATGG + Intergenic
1159741858 18:72181458-72181480 CACCCACACAGGTGCAGACAAGG + Intergenic
1159902785 18:74063665-74063687 CTCAAACAGACGCACAGAGAAGG - Intergenic
1160418915 18:78731061-78731083 CTCACAGACAGGCGGTGGGAGGG - Intergenic
1160715588 19:575184-575206 CACACACACACGCGCACACACGG - Intronic
1160941278 19:1621485-1621507 CACCCACCCAGGCCCAGAGAGGG - Intronic
1160941287 19:1621511-1621533 CACCCACCCAGGCCCAGAGAGGG - Intronic
1163844952 19:19633457-19633479 CTAAAACACAGGCACTGAGAGGG + Intronic
1165251594 19:34541025-34541047 CACACACACAGGCACACACAGGG + Intergenic
1165608819 19:37132781-37132803 CTCACACAGATGCAAAGAGAAGG + Intronic
1166223243 19:41378804-41378826 CTCACACACACACACAAAGAGGG - Intronic
1166513603 19:43428670-43428692 CACACACACACACACAGAGAAGG + Intergenic
1167574340 19:50310541-50310563 AACACACACAGCCACAGAGATGG - Exonic
1167704134 19:51068476-51068498 CCCACACCCAGGCCCAGAGGAGG + Intergenic
1167713611 19:51126639-51126661 CTCACACACAGCCCTAGAGGAGG - Intronic
1168003158 19:53465195-53465217 CTCACACACAGGGTTAAAGAAGG - Intergenic
1168146326 19:54421583-54421605 CTCACACACAGGCCCAGCCCTGG + Intronic
925415663 2:3668522-3668544 CACACTCACAGAGGCAGAGAGGG - Intronic
928592139 2:32827924-32827946 CACACACACAGACACAAAGAGGG - Intergenic
929522036 2:42662277-42662299 CTCACACACATGCTCACAAAGGG - Intronic
930018701 2:46987798-46987820 CACACACACACGCGCGGAAAGGG - Intronic
930463685 2:51716802-51716824 CGCACACACAGGCACACACACGG - Intergenic
932319365 2:70809790-70809812 CTCACTGACAGGGGCACAGAGGG - Exonic
932325941 2:70861849-70861871 TTCACACCCAGGCTCAGATATGG + Intergenic
932877376 2:75467285-75467307 CTGACACACAGACCCAGTGAAGG - Intergenic
933943233 2:87262679-87262701 CACACACATAGGCACACAGAGGG - Intergenic
934620325 2:95799577-95799599 ATCACACACAGGCTGAGAGCAGG - Intergenic
934904603 2:98187652-98187674 CACACACACAGACACAGAGACGG - Intronic
936574324 2:113641012-113641034 CTAACACCCAGGTGCAGGGATGG - Intronic
937230833 2:120397188-120397210 CTCACTCACAGGCACAGAGCTGG + Intergenic
937308880 2:120889149-120889171 CTGAGACACAGGGGCAGAAAAGG - Intronic
938926841 2:136051170-136051192 CTAACACACATGCATAGAGATGG + Intergenic
940189442 2:151024704-151024726 TTCACACACAGGGGAAGAAATGG + Intronic
942422560 2:175822962-175822984 CACACACACAGGCACACAGAGGG + Intergenic
942588589 2:177514879-177514901 CTCCCACACAGAAGCAGAAACGG - Intronic
943422168 2:187679432-187679454 CACACACACAGACACAGACATGG + Intergenic
943447609 2:188007579-188007601 CACACACACACGCTCAGAGCAGG + Intergenic
945974109 2:216257641-216257663 TTCACACACAGGCACACAGAAGG + Intergenic
948849761 2:240699860-240699882 CTCCCACACAGGCAGAGAGCTGG + Intergenic
1169919395 20:10718385-10718407 CACACACACAGAAACAGAGAGGG + Intergenic
1170113764 20:12834592-12834614 CACACACACACACGCAGAGTTGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170812826 20:19687894-19687916 CTCATACACAGGAGCCCAGAAGG - Intronic
1171837147 20:30167842-30167864 CACACACACAGACAGAGAGAGGG + Intergenic
1171973617 20:31579873-31579895 CACACACACACACGCAGAAAGGG - Intergenic
1172228253 20:33319766-33319788 CTGACACGGAGGCCCAGAGAAGG + Intergenic
1172762341 20:37331630-37331652 CTGCCAGACAGGCCCAGAGAGGG - Intergenic
1172776260 20:37408913-37408935 CTGACACACAGACGGACAGATGG - Intergenic
1173009591 20:39169878-39169900 CTCACATTCAAGGGCAGAGAGGG - Intergenic
1173123652 20:40316936-40316958 CACACACACAGACAGAGAGAGGG - Intergenic
1173959254 20:47058428-47058450 CTCACACACAGGCCCACAAGGGG + Intronic
1174185694 20:48704420-48704442 CTCACCCACAAGGGGAGAGAAGG - Intronic
1174404510 20:50294695-50294717 CACACAGACAGGCCCAGAGGTGG + Intergenic
1174578842 20:51556677-51556699 CTCAAGCACAGGCAAAGAGAGGG + Intronic
1175243248 20:57565209-57565231 CCCACACACAGACACAGAAAAGG - Intronic
1175519674 20:59592165-59592187 CACACACAAAGGCCCTGAGATGG - Intronic
1175873234 20:62218109-62218131 CACACACACAGGCCCCGGGAAGG - Intronic
1176628526 21:9116009-9116031 CACACACTCAGCCGCAGTGAGGG - Intergenic
1176665473 21:9683073-9683095 CACACACAGATGCACAGAGAAGG - Intergenic
1177053736 21:16273148-16273170 CACACACACAGAGACAGAGAGGG + Intergenic
1177985257 21:27966643-27966665 CACACACACACACGCACAGATGG + Intergenic
1180708742 22:17825545-17825567 GGCACACACAGCCGCAGGGAAGG - Intronic
1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG + Intronic
1182420334 22:30245749-30245771 CACACACACCGGCTCAGGGAGGG + Intronic
1182454362 22:30440347-30440369 CCCACACACTGGGGCAGGGAGGG - Intergenic
1183008531 22:34925145-34925167 CGCACACACACGCACACAGATGG - Intergenic
1183166311 22:36149583-36149605 ATCACACACAGGCCAGGAGATGG + Intronic
1183180491 22:36256850-36256872 ATCACACACAGGCCAGGAGATGG - Intronic
1183472609 22:38017486-38017508 GACACCCACAGGCCCAGAGATGG - Intronic
1183818466 22:40323919-40323941 CACACACACAGAGACAGAGAAGG - Exonic
1184262221 22:43325046-43325068 CACACAGACACGCGGAGAGAAGG + Intronic
1184794022 22:46720990-46721012 CTCAGATACAGGCACAGAGCAGG + Exonic
1185225658 22:49650596-49650618 CACACACAGAGCCGCAGAGCTGG - Intronic
1185425848 22:50769876-50769898 CTAACACCCAGGTGCAGGGATGG + Intronic
950479187 3:13234222-13234244 CACACCCACAGGCACAGACACGG - Intergenic
950479194 3:13234250-13234272 CACACCCACAGGCACAGACACGG - Intergenic
950479200 3:13234278-13234300 CACACCCACAGGCACAGACACGG - Intergenic
951706053 3:25545554-25545576 CGCACACACAGGGGCACGGAGGG - Intronic
951717525 3:25664815-25664837 CTCACACACACACACCGAGAGGG + Intronic
953848578 3:46448544-46448566 CTCACACAGAGGGACAGACATGG - Intronic
954622876 3:52005791-52005813 CTCCCACCCTGGCGCAGAGGAGG + Intergenic
954749878 3:52807426-52807448 CTCCCACTGAGGCTCAGAGAAGG + Intronic
956200574 3:66701416-66701438 CTAAAGCACAGGCGTAGAGACGG - Intergenic
956932777 3:74064384-74064406 CACACACACACACACAGAGAGGG + Intergenic
957094736 3:75768225-75768247 CACACACTCAGCCGCAGTGAGGG - Intronic
958134589 3:89471713-89471735 CACACACAGAGACTCAGAGAGGG - Intronic
958544290 3:95521972-95521994 CTCAGACACAGGCGCACTAAAGG - Intergenic
958841933 3:99216187-99216209 CTCATATACAGGGGCAGAGGGGG + Intergenic
961793753 3:129394714-129394736 CACACACACACACACAGAGACGG + Intergenic
963047778 3:141115958-141115980 CTCAGAAACAGGCCCAGAGGAGG - Intronic
963464359 3:145659585-145659607 CACACACACACACGGAGAGAGGG - Intergenic
965326134 3:167307037-167307059 CACCCACACAGGTGCAGAAAAGG + Intronic
967041783 3:185700214-185700236 CACACACAGAGGTACAGAGATGG + Intronic
967233928 3:187366812-187366834 CTCACACCCAGGTGGAGACAGGG - Intergenic
968034920 3:195540167-195540189 CTCACAGACAGCCACAGAGCAGG + Intronic
968318816 3:197747680-197747702 CTCTCACAAATGAGCAGAGATGG + Intronic
968372714 4:10805-10827 CGCAGGCACAGGCGCAGAGACGG + Intergenic
968403337 4:317215-317237 CTGACACACAGCTGGAGAGAAGG - Intergenic
968513598 4:1005830-1005852 CTCACACACAGCCTCTGAGATGG + Intergenic
969038184 4:4273038-4273060 CCCAGAAACAGGCCCAGAGATGG + Intronic
969605437 4:8200030-8200052 ATCACGCACAGGCCCAGAGGGGG - Intronic
971786803 4:31114656-31114678 CACACACACACACGAAGAGATGG + Intronic
977378257 4:96236951-96236973 CTCACACATATGAGCATAGATGG - Intergenic
978250711 4:106628341-106628363 CTCACACACACGCACACATATGG + Intergenic
983929476 4:173437269-173437291 CACACACACACGCACAGAGTAGG + Intergenic
984629423 4:182045183-182045205 CTCACACCCAGGCTCAGAGATGG - Intergenic
984714914 4:182916991-182917013 CCCACACACGGGCGCAGGAAGGG + Intronic
985018475 4:185661900-185661922 CTCAGACACAGGTGGAGACATGG + Intronic
985203721 4:187510022-187510044 CACACACACAGGGAAAGAGAAGG + Intergenic
985410963 4:189683531-189683553 CACACACAGATGCACAGAGAAGG - Intergenic
985462691 4:190121819-190121841 CGCAGGCACAGGCGCAGAGACGG - Intergenic
985911469 5:2887366-2887388 CCCACACCCAGGCCCAGACAGGG - Intergenic
985958649 5:3283123-3283145 GACACACACAGGCGCACACACGG + Intergenic
985958658 5:3283243-3283265 GACACACACAGGCGCACACACGG + Intergenic
986441740 5:7788690-7788712 CACACACACATGCACACAGATGG - Intronic
992564016 5:77980340-77980362 CACACACACACACTCAGAGAGGG - Intergenic
993291474 5:86077684-86077706 ATCACACACAGGCGCCTATAGGG - Intergenic
993457433 5:88142223-88142245 CACACACACACACACAGAGACGG + Intergenic
994909424 5:105883458-105883480 CACACACACACACACAGAGAAGG + Intergenic
995643277 5:114281619-114281641 CACACACACACACACAGAGATGG - Intergenic
998133985 5:139665209-139665231 CTCACACACAGGCGCAGAGAGGG - Intronic
998374191 5:141680549-141680571 CTCAGACTCTGGGGCAGAGAGGG - Intronic
999300546 5:150487453-150487475 CTGAGACACAGGCTGAGAGAGGG - Intronic
1002556621 5:180046634-180046656 GACACACACAGGCTCTGAGAGGG - Intronic
1002595278 5:180318062-180318084 GGCAGACACAGGAGCAGAGAAGG + Intronic
1002845136 6:938877-938899 CCCACACACAGGGGCACTGAAGG + Intergenic
1002867177 6:1131747-1131769 CACACACACACGGACAGAGACGG - Intergenic
1004084286 6:12429435-12429457 CACACACACAGGCACACAGAAGG - Intergenic
1004278476 6:14258822-14258844 CTCACACAGGGAGGCAGAGAGGG + Intergenic
1004848281 6:19669767-19669789 TTCACCCACAGGGGCAGAGCAGG + Intergenic
1007084498 6:39133937-39133959 ATTACACACAGCCGAAGAGAAGG - Intergenic
1007167013 6:39835873-39835895 CAAAGACACAGGCCCAGAGAGGG + Intronic
1007320734 6:41027390-41027412 CTGAAACACAGGTGCAGAGCGGG + Exonic
1007369563 6:41417402-41417424 CTCACACACAGCCTCAGGGCTGG - Intergenic
1007696676 6:43738075-43738097 CACACACACAGGGGCTGAGATGG - Intergenic
1007759921 6:44127661-44127683 CTCACCCCCAGGCGCAGACTCGG - Intronic
1011163766 6:84422409-84422431 CTCAACCACTGGTGCAGAGAAGG + Intergenic
1012450440 6:99349066-99349088 CCCGCACAGGGGCGCAGAGAGGG - Intronic
1013651451 6:112199222-112199244 ATCACACAGGGGTGCAGAGAAGG - Intronic
1013733473 6:113198809-113198831 CTCACACAGATTCGAAGAGAGGG - Intergenic
1014180023 6:118374295-118374317 CTCAGACTCAGGCTCAGAGATGG + Intergenic
1014353924 6:120379889-120379911 CTCATACACAGGCTAAGAAATGG + Intergenic
1017065044 6:150520699-150520721 CACACACACACACACAGAGAAGG - Intergenic
1017263179 6:152411732-152411754 CACACACACACACACAGAGATGG + Intronic
1018229393 6:161661359-161661381 CAGACACACAGGCCCTGAGATGG - Intronic
1018335269 6:162780082-162780104 CTCACACACATGCACTGAGGGGG - Intronic
1019191789 6:170255676-170255698 CACTCACACAGGGGCAGGGAGGG - Intergenic
1021364729 7:19763056-19763078 TGCACACCCAGGCACAGAGAAGG - Intronic
1022465343 7:30649619-30649641 CACACGCACAGACCCAGAGAGGG - Intergenic
1022515759 7:30974221-30974243 CTCACTCTGAGGCCCAGAGAAGG + Intronic
1022621355 7:31987912-31987934 GTCACCCCCAGGCACAGAGAAGG - Intronic
1023079292 7:36512779-36512801 CTCACACAAGGGGGCAGAGCAGG - Intergenic
1024098587 7:46006214-46006236 GTCACACACAGGTGCTGAGAAGG - Intergenic
1024366767 7:48529084-48529106 CTACCACACAGGTGCAGAAAGGG - Intronic
1024658347 7:51471332-51471354 CTCCCTCACAGGCGCAGATTGGG + Intergenic
1027556765 7:79673563-79673585 TTCACACACAGGTGAATAGATGG + Intergenic
1028426276 7:90693050-90693072 TTCACACACAGGCTAAAAGACGG - Intronic
1029271781 7:99381311-99381333 CTCACACACAGGCACACTGCAGG - Intronic
1029477330 7:100792711-100792733 CTCCCAGGCAGGGGCAGAGAAGG - Intronic
1029623875 7:101707473-101707495 CTCCCACACAGGGGCAGGAAAGG - Intergenic
1033017675 7:137688490-137688512 GTCACACAAAAGGGCAGAGAAGG + Intronic
1033912884 7:146285972-146285994 CACACACACACACACAGAGAAGG - Intronic
1034385506 7:150737589-150737611 CCCGCACACAGACGCAGAGCAGG + Exonic
1034475175 7:151277448-151277470 CGCACACACAGGCACACAAACGG + Intronic
1034725523 7:153331968-153331990 CCCACACACAGGCTCAGAACTGG - Intergenic
1035599941 8:891484-891506 CGCACACACGGGTGCAGGGAAGG - Intergenic
1037817258 8:22118795-22118817 CGCACAGACAGGTGCAGAGAAGG - Intronic
1037996270 8:23354582-23354604 CACACACACACACACAGAGAAGG - Intronic
1039030499 8:33304029-33304051 AGAACACACAGACGCAGAGAGGG + Intergenic
1039506357 8:38055216-38055238 CTCACACTCAGACTCCGAGATGG + Intronic
1039549207 8:38430773-38430795 CTCCCACCCAGGGACAGAGAAGG - Intronic
1039927261 8:41946527-41946549 CACACACACACACACAGAGAAGG + Intronic
1040551091 8:48438248-48438270 CACACACACAGACACACAGACGG + Intergenic
1041313548 8:56539736-56539758 CACACACAGAGGCAGAGAGAGGG + Intergenic
1041539784 8:58970580-58970602 CACAGACATAGGCACAGAGAAGG - Intronic
1042188081 8:66156796-66156818 CTCACACACAGTTCCAGACACGG - Intronic
1042307011 8:67343279-67343301 CTCATACATGGACGCAGAGAAGG + Exonic
1044186929 8:89264584-89264606 CTCAGGCACAGGGGCAGTGAGGG - Intergenic
1044805994 8:96008910-96008932 CACACACACAGAAGCAGGGAGGG - Intergenic
1044984849 8:97748363-97748385 CCCACACACATGCGCTAAGATGG + Intergenic
1048345077 8:133570169-133570191 CACACACCCAGCCGCAGAGCGGG + Intronic
1049172167 8:141168295-141168317 CTCCCACTCAGGGGCAGACATGG - Exonic
1050735725 9:8760586-8760608 CACACACACAGACAGAGAGAGGG - Intronic
1051738511 9:20228394-20228416 CTCACATACACACCCAGAGAAGG + Intergenic
1052801281 9:32970486-32970508 CTCAGAGACAGGCCCAGAGAAGG + Intergenic
1053104624 9:35399166-35399188 CTCACACACAGTGGCAAAGAGGG - Exonic
1055665337 9:78547209-78547231 CACACACACAGTCATAGAGACGG - Intergenic
1056035279 9:82598201-82598223 CACACACACATGCACACAGAGGG - Intergenic
1056781409 9:89553785-89553807 CTGCCACACAGTGGCAGAGAAGG - Intergenic
1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG + Intergenic
1059875990 9:118635421-118635443 CACACACACAGGCACACACACGG + Intergenic
1061536655 9:131254479-131254501 CCTGCACACAGGCACAGAGATGG + Intergenic
1061572166 9:131484636-131484658 AACACAAACAGGTGCAGAGATGG - Intronic
1061595980 9:131629305-131629327 AGCACACACAGGCCCTGAGAGGG + Intronic
1062025766 9:134339569-134339591 CACACACACAGGCTCACAAAAGG - Intronic
1062337122 9:136076469-136076491 CTCACACGCGGGCACAGAGCAGG + Intronic
1203751371 Un_GL000218v1:83688-83710 CACACACTCAGCCGCAGTGAGGG - Intergenic
1203660625 Un_KI270753v1:38687-38709 CACACACAGATGCACAGAGAAGG + Intergenic
1203671799 Un_KI270755v1:21905-21927 CACACACAGATGCACAGAGAAGG + Intergenic
1186100350 X:6149530-6149552 CTCACACACACACACAAAGAGGG + Intronic
1186754416 X:12655330-12655352 CACACACACAGGGATAGAGATGG - Intronic
1188237633 X:27749317-27749339 CACACACACAGTCTCAGAAAAGG + Intergenic
1189795673 X:44644070-44644092 CTCACACACAAGCTCAGGTACGG + Intergenic
1191699218 X:64021476-64021498 CTCACAGACACGCCCAGAAATGG - Intergenic
1191718154 X:64206722-64206744 CCCACACACAGTAGCAGACAAGG - Intergenic
1193918233 X:87393749-87393771 CACACACACAGTCACAGATATGG - Intergenic
1195386799 X:104321229-104321251 CCCACACACAAGGGGAGAGAAGG - Intergenic
1197825010 X:130579990-130580012 CACACACACAGACACAAAGATGG - Intergenic
1199739776 X:150723768-150723790 CACAGACACAGACGCAAAGAAGG - Intronic
1200001243 X:153060863-153060885 CTCACACACACTCACAGAGATGG - Intergenic